ID: 1167983983

View in Genome Browser
Species Human (GRCh38)
Location 19:53299682-53299704
Sequence CAGGCGCTTGCCCTGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167983983_1167983996 28 Left 1167983983 19:53299682-53299704 CCAGGACCCAGGGCAAGCGCCTG No data
Right 1167983996 19:53299733-53299755 GACATGTCAGGCCTGTTGGCTGG No data
1167983983_1167983990 2 Left 1167983983 19:53299682-53299704 CCAGGACCCAGGGCAAGCGCCTG No data
Right 1167983990 19:53299707-53299729 TGGCAGGCTGGAGAGCACCATGG No data
1167983983_1167983995 24 Left 1167983983 19:53299682-53299704 CCAGGACCCAGGGCAAGCGCCTG No data
Right 1167983995 19:53299729-53299751 GGAGGACATGTCAGGCCTGTTGG No data
1167983983_1167983988 -10 Left 1167983983 19:53299682-53299704 CCAGGACCCAGGGCAAGCGCCTG No data
Right 1167983988 19:53299695-53299717 CAAGCGCCTGCATGGCAGGCTGG No data
1167983983_1167983991 3 Left 1167983983 19:53299682-53299704 CCAGGACCCAGGGCAAGCGCCTG No data
Right 1167983991 19:53299708-53299730 GGCAGGCTGGAGAGCACCATGGG No data
1167983983_1167983992 6 Left 1167983983 19:53299682-53299704 CCAGGACCCAGGGCAAGCGCCTG No data
Right 1167983992 19:53299711-53299733 AGGCTGGAGAGCACCATGGGAGG No data
1167983983_1167983993 16 Left 1167983983 19:53299682-53299704 CCAGGACCCAGGGCAAGCGCCTG No data
Right 1167983993 19:53299721-53299743 GCACCATGGGAGGACATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167983983 Original CRISPR CAGGCGCTTGCCCTGGGTCC TGG (reversed) Intergenic
No off target data available for this crispr