ID: 1167994859

View in Genome Browser
Species Human (GRCh38)
Location 19:53394269-53394291
Sequence GGGAATCGCTGAAACCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134303
Summary {0: 1, 1: 40, 2: 2010, 3: 31841, 4: 100411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167994850_1167994859 30 Left 1167994850 19:53394216-53394238 CCGGGCATGGTGGCACGCGCCTG 0: 505
1: 8467
2: 47951
3: 129857
4: 225562
Right 1167994859 19:53394269-53394291 GGGAATCGCTGAAACCCAGGAGG 0: 1
1: 40
2: 2010
3: 31841
4: 100411
1167994852_1167994859 11 Left 1167994852 19:53394235-53394257 CCTGTAATTGCAGATACTCTGGA 0: 1
1: 5
2: 643
3: 14081
4: 140793
Right 1167994859 19:53394269-53394291 GGGAATCGCTGAAACCCAGGAGG 0: 1
1: 40
2: 2010
3: 31841
4: 100411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167994859 Original CRISPR GGGAATCGCTGAAACCCAGG AGG Intronic
Too many off-targets to display for this crispr