ID: 1167999802

View in Genome Browser
Species Human (GRCh38)
Location 19:53436020-53436042
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 3, 1: 6, 2: 19, 3: 48, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167999800_1167999802 5 Left 1167999800 19:53435992-53436014 CCAGCTTCAGCTGTGCATAGACT 0: 2
1: 2
2: 0
3: 9
4: 114
Right 1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG 0: 3
1: 6
2: 19
3: 48
4: 255
1167999797_1167999802 10 Left 1167999797 19:53435987-53436009 CCCCTCCAGCTTCAGCTGTGCAT 0: 3
1: 2
2: 13
3: 106
4: 431
Right 1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG 0: 3
1: 6
2: 19
3: 48
4: 255
1167999799_1167999802 8 Left 1167999799 19:53435989-53436011 CCTCCAGCTTCAGCTGTGCATAG 0: 3
1: 4
2: 8
3: 26
4: 271
Right 1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG 0: 3
1: 6
2: 19
3: 48
4: 255
1167999798_1167999802 9 Left 1167999798 19:53435988-53436010 CCCTCCAGCTTCAGCTGTGCATA 0: 3
1: 1
2: 3
3: 47
4: 258
Right 1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG 0: 3
1: 6
2: 19
3: 48
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900394286 1:2446779-2446801 GCCTGCAGAGGGGTCAGAGCCGG + Intronic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
903033766 1:20481379-20481401 GGCTCCAGAGGGCCCAGAGTGGG - Intergenic
903041237 1:20532370-20532392 GCCTCCAGAAGGAACATAGCTGG + Intergenic
904710213 1:32424674-32424696 GCCTCCAGAGTCATCAGAAGAGG - Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905286768 1:36885697-36885719 GCCCCCACAGGGACCAGGGCAGG + Intronic
905468896 1:38176706-38176728 GTGTCCAGAGTGAGCGGAGCAGG - Intergenic
906060861 1:42947750-42947772 GCAGCCAGAGTGACGAGAGTAGG + Intronic
906737081 1:48140733-48140755 GCCTCCAGAGTAGACAGAGTAGG + Intergenic
908114293 1:60925681-60925703 ACCTACAGAGTGACCTGGGCAGG + Intronic
909531081 1:76682336-76682358 GTCCCTAGAGTGACCAGAGGTGG - Intergenic
910592317 1:88939457-88939479 GCCTCCAGAGGGGCCAGAAGAGG - Intronic
912233085 1:107818100-107818122 GTTTCCAGAGTGAGGAGAGCAGG + Intronic
914808184 1:151007091-151007113 GGCTCCAGAGGGAAAAGAGCTGG - Intronic
915628623 1:157134625-157134647 GCCTCCAGACTAACCACATCAGG - Intronic
917265254 1:173214296-173214318 GGCTCCAGAGTAAACAAAGCTGG - Intergenic
919793680 1:201308502-201308524 GTCTCCATAATGACCAGAGTTGG - Intronic
920417934 1:205811242-205811264 GCCTCCAGATGGAGCAGTGCAGG - Intronic
921433691 1:215091733-215091755 GCCTCCTTAGTGACCATATCTGG - Intronic
921866771 1:220094508-220094530 GCCTCCAGAGAGGCCCGATCCGG + Intronic
922500951 1:226096541-226096563 GCCTCCAGGGGGACCACAGCTGG - Intergenic
922982978 1:229844064-229844086 GCCTGCAGAATCACCAGAGAAGG - Intergenic
924457554 1:244230778-244230800 GCCTCCAGAGAGTCCACGGCGGG + Intergenic
1064594327 10:16928180-16928202 GACTCCAGTGTAACCAGGGCAGG - Exonic
1065800145 10:29344575-29344597 GCCTCCAGAGAGCCCTGTGCCGG + Intergenic
1067011075 10:42714453-42714475 GACTCCAGTGTAACCAGGGCAGG - Intergenic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1067312522 10:45127418-45127440 GACTCCAGTGTAACCAGGGCAGG + Intergenic
1069571799 10:69498651-69498673 ACCACCAAAGTGCCCAGAGCAGG - Intronic
1069982105 10:72260080-72260102 GCCTCCAGGGCGACCAGCTCTGG + Intergenic
1070599104 10:77853501-77853523 GGCTCCTGAGTGACCAGACTCGG - Exonic
1072105670 10:92271060-92271082 GCCTCCTGAGTGACTGGGGCTGG - Intronic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1073100327 10:101003040-101003062 GGCTCCAGATTCACCAGACCTGG + Intronic
1074308335 10:112299511-112299533 GCCTCCTGCGAGACCAGACCGGG + Exonic
1074892093 10:117744203-117744225 GCTTCCAGAGTGGTCAGAGAGGG + Intergenic
1076569079 10:131420487-131420509 GCCCCCAGAGAGAGCAGCGCTGG - Intergenic
1077309739 11:1883006-1883028 GCCCCCACAGGGAGCAGAGCAGG + Intronic
1077324442 11:1957638-1957660 GCCTCCAGGGGGCCCTGAGCTGG + Intronic
1077474472 11:2779828-2779850 GCCTGCAGAGGGGCCAGCGCTGG + Intronic
1079925645 11:26488805-26488827 GCCTCGAAAGGGACCCGAGCAGG + Intronic
1082097653 11:48144301-48144323 GCAGCCAGACTGACCAGTGCTGG + Intronic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1083479418 11:62934061-62934083 GACTGCAGAGTGGCCAGAGTGGG - Intergenic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084430241 11:69106856-69106878 ACCTGCTGAGTGACCAGGGCAGG + Intergenic
1084561464 11:69907872-69907894 GCCTCCATGGAGGCCAGAGCAGG + Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1090751030 11:129746684-129746706 GCCTCAAGAAGGCCCAGAGCAGG - Intergenic
1202807423 11_KI270721v1_random:12815-12837 GCCTCCAGGGGGCCCTGAGCTGG + Intergenic
1096339859 12:50788601-50788623 GCCTCCTGAGTAGCTAGAGCTGG + Intronic
1096741906 12:53699661-53699683 GCCTGCACAGTGCCCAGAGGCGG + Intergenic
1096805907 12:54141025-54141047 CCCTCCACAGAGGCCAGAGCAGG + Intergenic
1097981889 12:65743734-65743756 GCCTCCAGAGTAACCCGTGGCGG + Intergenic
1099443778 12:82728658-82728680 TCCTCAAGCGTGACCAGAGTGGG - Intronic
1101761763 12:107664511-107664533 GCCTCCAGAGTAGCCACAGGTGG + Intergenic
1102631386 12:114283859-114283881 ACCTCCAGACTGACAAGAGAAGG + Intergenic
1102706513 12:114885491-114885513 GCCTCCAGAGTAGCTAGACCAGG + Intergenic
1103414865 12:120737213-120737235 GTCTCCAGAGAGATCAGGGCTGG - Intronic
1103883007 12:124180831-124180853 GCCTCAAGAGAAACCAGACCTGG + Intronic
1105296493 13:19091243-19091265 GCCCCCAGGGTGTCCAGAGGAGG + Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1115521278 14:34235132-34235154 CCCTACAGAATGAGCAGAGCAGG + Intronic
1117444080 14:55787149-55787171 GCCCTCAGAGGGACCATAGCTGG - Intergenic
1118180412 14:63486750-63486772 GCCTTCAGAGTTAACAGACCAGG - Intronic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1122691747 14:103534942-103534964 GCCTCCTGGGTGGCCAGAGTGGG + Exonic
1122737859 14:103854164-103854186 TCCTCCAGACTGCCCAGACCTGG + Intergenic
1122896486 14:104760105-104760127 GACTCCAGAGGGAGCACAGCTGG - Intronic
1123066111 14:105620246-105620268 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1123070255 14:105639299-105639321 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1123074845 14:105662958-105662980 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1123089492 14:105736083-105736105 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1123095280 14:105764243-105764265 CCCCGCAGAGTGACCAGGGCAGG + Intergenic
1124121214 15:26890784-26890806 TCCTCCTGAGTGCCCAGTGCCGG - Intronic
1125403683 15:39331318-39331340 GCTTCCAGAGTGACCATTTCAGG - Intergenic
1125631376 15:41150257-41150279 GCCTCCAGAGTAAATTGAGCAGG - Intergenic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128739814 15:70075922-70075944 GCCTCCAGACTGGCCGGAGAAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1129061871 15:72866955-72866977 TCCTCCAGAGTGGCCAGCACTGG - Intergenic
1129298216 15:74611296-74611318 AGCTCCAGAATGCCCAGAGCTGG - Intronic
1129714189 15:77837410-77837432 GAGTCCAGTGTGACCAGAGCTGG - Intergenic
1129851567 15:78796772-78796794 GCCTCCAGTGTACCCAGAGCTGG - Exonic
1130658023 15:85806199-85806221 GGCGACAGAGTGAACAGAGCAGG + Intergenic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1135228128 16:20679313-20679335 GCCTCCAGTGTGGTCAGAGCAGG - Intronic
1136716910 16:32288819-32288841 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1136835286 16:33495064-33495086 GCTTGCAGAGGGAACAGAGCTGG + Intergenic
1137254764 16:46765738-46765760 GCCTCCAGAGTAACTAGCTCCGG - Intronic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1138351665 16:56349218-56349240 GCCACTAGAGTGACCTGAGCTGG - Intronic
1138352277 16:56352387-56352409 GCCCCTAGAGGGACCAGGGCTGG - Intronic
1140065941 16:71611202-71611224 GCCTGCAGGGGGCCCAGAGCTGG - Intergenic
1140557955 16:75943278-75943300 GCTATCAGAGTGATCAGAGCAGG + Intergenic
1203009517 16_KI270728v1_random:228968-228990 GCTTGCAGAGGGAACAGAGCTGG - Intergenic
1203145458 16_KI270728v1_random:1795385-1795407 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1142614003 17:1124697-1124719 CCTTCCAGAGTGAACAGAGGAGG + Intronic
1143757305 17:9076273-9076295 GCCTGCACACTGACCACAGCTGG + Intronic
1144678390 17:17176358-17176380 ACCTCCAGAGTCTCCACAGCAGG - Intronic
1145755049 17:27384336-27384358 GCCTGCACTGAGACCAGAGCCGG - Intergenic
1146223836 17:31049311-31049333 GCCTCCAGAGTCATCAGAAGAGG - Intergenic
1146812250 17:35913346-35913368 GCCTCCAGAGCTACCTAAGCAGG - Intergenic
1147741680 17:42673903-42673925 GCCTCCAGAGTGCACTGAGGGGG + Intronic
1148446253 17:47739368-47739390 GCCTCCCGAGTCACCCGAGCGGG - Intronic
1150217003 17:63476679-63476701 GCCTCCGGAGTGACAAGGCCGGG - Intergenic
1150431690 17:65123280-65123302 GCCTCCCGTGAGCCCAGAGCAGG + Intergenic
1151882956 17:76905864-76905886 GGCACCAGAGTGACCAGATCGGG - Intronic
1152061080 17:78075705-78075727 GCCACATGAGTGACCACAGCTGG + Intronic
1152842271 17:82577697-82577719 GCCTCCAAAGGGACTAGAGCTGG + Intronic
1153761960 18:8340091-8340113 GCCACCACAGTGACCAGGCCAGG + Intronic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG + Intergenic
1154294798 18:13138547-13138569 GCCTCCCGAGGTACAAGAGCAGG - Intergenic
1155526576 18:26721850-26721872 GCCTCCAGAGTGGTATGAGCAGG + Intergenic
1156622939 18:38874239-38874261 GCCCCCTGAGTGGACAGAGCTGG - Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1160941190 19:1621170-1621192 GGCTCCCGAGGGACCACAGCTGG - Exonic
1161260604 19:3335781-3335803 GCCACCGGTGTGACCAGACCAGG + Intergenic
1162584299 19:11549723-11549745 GACTCCCGAGTACCCAGAGCTGG + Exonic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164010589 19:21200397-21200419 GCTTCCACTGTGATCAGAGCAGG + Intergenic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164054456 19:21610008-21610030 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1165129526 19:33623023-33623045 GCCTCCAGCGAGGCCAGAGCGGG - Intronic
1166083541 19:40459982-40460004 GCCTACAGACTGACCAGTGCTGG + Intronic
1167302330 19:48685395-48685417 ACCTCAAGACTGACCAGGGCTGG - Intergenic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
927990066 2:27441700-27441722 TCCCCCAGGCTGACCAGAGCCGG + Exonic
929898895 2:45984640-45984662 GCCGCAAGAGTCCCCAGAGCAGG - Exonic
930316010 2:49797766-49797788 TCTTCCAGAGTGCCCAGAACTGG - Intergenic
930647709 2:53929372-53929394 GCCTCCACATTGCCCAGATCAGG + Intronic
931345479 2:61441437-61441459 GGCTGCAGAGAGACTAGAGCTGG + Intronic
933060908 2:77735228-77735250 TCCTCAAGAGTGGCCAGAGTGGG + Intergenic
933723870 2:85415152-85415174 GTCTGCAGAGTGAGCAGAGTTGG - Intronic
933978769 2:87533607-87533629 ACAGCCAGAGTGACCAGAACTGG + Intergenic
934474918 2:94587445-94587467 GCCTCCTCAGTGCCCAGATCTGG + Intergenic
934614306 2:95761783-95761805 CCCAGCAGAGTGAGCAGAGCTGG + Intergenic
934646595 2:96062704-96062726 CCCAGCAGAGTGAGCAGAGCTGG - Intergenic
934662479 2:96150479-96150501 GGCTCCCCTGTGACCAGAGCTGG + Intergenic
934759784 2:96848159-96848181 GCTTCCACAGTGACCAGACTGGG + Exonic
935366449 2:102296583-102296605 GCCTCAAGTGTAAGCAGAGCTGG + Intergenic
935607099 2:104982257-104982279 CCCTCCACAGTGACATGAGCAGG + Intergenic
935757899 2:106291182-106291204 GCTTCCTCAGTGAACAGAGCAGG + Intergenic
936315061 2:111417199-111417221 ACAGCCAGAGTGACCAGAACTGG - Intergenic
940109076 2:150130667-150130689 GCTTCCAGAGCGACAAGAACTGG + Intergenic
943356850 2:186867088-186867110 GTCCTCTGAGTGACCAGAGCTGG + Intergenic
946808906 2:223501367-223501389 GACACCTCAGTGACCAGAGCTGG - Intergenic
948594089 2:239068307-239068329 GGCCCCAGAGAGCCCAGAGCAGG - Intronic
948659915 2:239500727-239500749 TCCAGCAGAGTGACCGGAGCAGG - Intergenic
948825099 2:240570213-240570235 GCCTGCAGAGTGGCCGGACCAGG + Intronic
1171003201 20:21435747-21435769 GTCTCCGGAGAGAGCAGAGCAGG + Intergenic
1172123482 20:32611883-32611905 GCCTCCTCTGTGAACAGAGCTGG - Intergenic
1172777533 20:37416175-37416197 GCCTCCAGAGCCCCCAGAGAGGG - Intergenic
1172893522 20:38283733-38283755 GGCTCCAGAGAGATCTGAGCTGG + Intronic
1174446475 20:50594471-50594493 GCCTTCAGGGTGGCCACAGCTGG - Intronic
1174861770 20:54098017-54098039 GCCACCTGAGTGCCAAGAGCAGG + Intergenic
1175466725 20:59194448-59194470 GCCCCCAGGCTGGCCAGAGCTGG + Exonic
1175913384 20:62414939-62414961 ACCTCCAGAGTGGCCAGGCCTGG - Intronic
1175986174 20:62765140-62765162 ACCTCCAGAGTGACAGGAGCGGG - Intergenic
1176346348 21:5751893-5751915 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176353162 21:5872477-5872499 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176498479 21:7572562-7572584 GCCTCCAGTGTGGTCAGAGCAGG - Intergenic
1176540669 21:8149963-8149985 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1176559620 21:8333008-8333030 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1178619068 21:34158547-34158569 CCCTCCAGACAGCCCAGAGCAGG - Intergenic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179842321 21:44085149-44085171 GTCACCAGAATGACCAGGGCAGG - Intronic
1182473864 22:30565171-30565193 GCCTGCAGAGAGCCCAGAACAGG + Intronic
1182621066 22:31618871-31618893 GGCACCAGAGTGAACAGGGCAGG - Exonic
1182829769 22:33295574-33295596 GCCTCCAGAGTGAGCAGCACAGG - Intronic
1183616714 22:38950231-38950253 TCGTCCAGGGTGACCAGGGCCGG - Intergenic
1183627731 22:39014874-39014896 GCCTCCACTGTGAGCAGAGTAGG + Intronic
1183633664 22:39048002-39048024 GCCTCCACTGTGAACAGAGGAGG + Intronic
1184010314 22:41743055-41743077 GCATCCAGAGAGACAAAAGCAGG - Intronic
1184461735 22:44641592-44641614 TCCTCCAGACAGACCAGAGGGGG + Intergenic
1185218871 22:49618838-49618860 GACAACAGAGTGACCAGTGCAGG + Intronic
1203245610 22_KI270733v1_random:66381-66403 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
949862244 3:8516277-8516299 CCCTCCTGAGAGACAAGAGCCGG + Intronic
950064977 3:10104741-10104763 GGGTCCATGGTGACCAGAGCTGG + Exonic
950189704 3:10968117-10968139 GCCCCCAGGGTGTCCAGAACAGG + Intergenic
952401889 3:32970797-32970819 GCTTCCAGTGTGGTCAGAGCAGG - Intergenic
952568564 3:34685637-34685659 GCCTCCAGTGTGGTCGGAGCAGG - Intergenic
953714530 3:45306555-45306577 TCCTCAAGCGTGACCAGAGTGGG - Intergenic
953983892 3:47426888-47426910 GGCTCAAGAGAGACCAGAGGAGG + Intronic
955582727 3:60442154-60442176 CCTTTCAGAGTGACCAGGGCTGG - Intronic
956449899 3:69363731-69363753 GGCTCCCCATTGACCAGAGCTGG + Intronic
957616179 3:82530445-82530467 TTTTCCAGAGTGACCAGGGCTGG + Intergenic
957792081 3:84954232-84954254 GCATGAAGAGTGACCAGAGGAGG + Intergenic
957858515 3:85912004-85912026 GCTTGCAGAGTGAGCAGAGATGG - Intronic
957970319 3:87375206-87375228 TCCTCAAGTGTGGCCAGAGCGGG - Intergenic
959071886 3:101709632-101709654 GCCTCCAGAAAGACTAGAGACGG - Intergenic
959871669 3:111335761-111335783 GCCTCCAAAGTTACCAGAATAGG - Intronic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
961091460 3:124116126-124116148 GCCACCAGAGGGAAGAGAGCTGG - Intronic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
962648789 3:137467046-137467068 GGCTCCAGAGTGCGTAGAGCAGG - Intergenic
963152222 3:142057126-142057148 GGATCCAGAGGGACCACAGCTGG + Intronic
963752862 3:149201242-149201264 GCCTCCAGAGTAACTAGGACAGG + Intronic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
967217126 3:187220227-187220249 GCCTCCAGAGTCACCCGCACAGG + Intronic
968480074 4:829353-829375 GCTTCCAGAGAGGCTAGAGCTGG - Intergenic
969314715 4:6374824-6374846 GCCTCCAGTGTGAACTGCGCAGG + Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
971264931 4:25088865-25088887 GCCTCCTGAGCGAGCAGCGCCGG - Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
972651591 4:41022540-41022562 GACTCCAGAGGGACAAGAGAAGG - Intronic
974549328 4:63350012-63350034 GCCTCCAGGGTTTCCAGCGCTGG - Intergenic
974976539 4:68901154-68901176 GCTCCCAGTGTGACTAGAGCAGG + Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
978761546 4:112359223-112359245 GGGTCCAGAGCGCCCAGAGCAGG + Intronic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
979728279 4:123991172-123991194 GTCCCCAGAGTGGCCACAGCAGG - Intergenic
982630186 4:157821893-157821915 TCCTCTAGTGTGGCCAGAGCAGG - Intergenic
984844430 4:184097875-184097897 GCCACCAGAGGAACCAGACCGGG + Intronic
985423477 4:189806623-189806645 GCCTGGAAAGGGACCAGAGCGGG + Intergenic
985633914 5:1026834-1026856 GCCTCCCGAGTGCCCTGAGGTGG + Intronic
986307344 5:6525519-6525541 GTCCCCACAGTGACCAGGGCAGG - Intergenic
990665776 5:58069583-58069605 TCCTCCAGCGTGGCCAGAGTGGG + Intergenic
991418093 5:66412102-66412124 GCCTCCAGGGTGACCATAGTGGG - Intergenic
991505365 5:67318750-67318772 TCCTCAAGCGTGGCCAGAGCAGG - Intergenic
992098445 5:73382604-73382626 GCCTCCAGAGGGAACAGGCCTGG + Intergenic
994401423 5:99285145-99285167 GCCTCCAGCTTTACCAGAGAAGG - Intergenic
998380455 5:141721273-141721295 GGCTCCAGAGTGAAGAAAGCAGG - Intergenic
999028978 5:148268842-148268864 ACATCCAAAGTGACAAGAGCAGG + Exonic
1000025409 5:157354735-157354757 GCCTCCAAAGTGAACCGAGTGGG + Intronic
1001130125 5:169056987-169057009 GTCTCCATAATGACAAGAGCAGG + Intronic
1001254567 5:170173509-170173531 GCCTACAGAGTGGCCAGCGCTGG + Intergenic
1002311124 5:178314432-178314454 ACCACCCCAGTGACCAGAGCTGG + Intronic
1002824871 6:763614-763636 GCCTTCAGAGGGAGCACAGCAGG + Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1007180633 6:39926920-39926942 ACCTCCAGAGTCAGCAGTGCTGG + Intronic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1008813075 6:55528840-55528862 GTCTCAAGAGTGACCAAAACAGG + Intronic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1011443502 6:87412412-87412434 GCCTACAGAGTGAGCAGTGAAGG + Intronic
1016984141 6:149881677-149881699 GCCTCCAGTGAGAACAGAGTGGG - Intergenic
1019408242 7:895162-895184 GCCTCCAGAGTGTCCTGTCCCGG + Intronic
1020112667 7:5456272-5456294 GCCTCCTGAGAGCCCAGGGCAGG - Intronic
1020212618 7:6167475-6167497 CCCTCCAGAGACTCCAGAGCAGG + Intronic
1020649334 7:10855544-10855566 CCCTCCAGAGAGCCCAGACCTGG + Intergenic
1022025316 7:26443050-26443072 GCTTTCAGAGAGACCACAGCGGG + Intergenic
1022046413 7:26625771-26625793 GCGCCCAGAATGCCCAGAGCTGG - Intergenic
1023861235 7:44218733-44218755 TCCCCCAGAAGGACCAGAGCTGG + Exonic
1023871708 7:44266763-44266785 GCCTCCTGAGTGGCCAGCCCTGG + Intronic
1024497644 7:50066809-50066831 GCCTCCAGTGTGGTCAGAGCAGG + Intronic
1024748264 7:52431711-52431733 TCCTCAAGAGTGGCCAGAGTGGG + Intergenic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1026051813 7:66953058-66953080 GCCTCCTAAATGACCAAAGCTGG - Intronic
1026919483 7:74144684-74144706 GCCTCCCGAGTAATCCGAGCCGG + Intergenic
1027878751 7:83804431-83804453 GCCTCCAGAGACACCAAACCTGG - Intergenic
1028058802 7:86282626-86282648 TCCTCAAGAGTGGCCAGAGAGGG + Intergenic
1029110114 7:98209741-98209763 AGCTCCAGAGGGACCAGGGCAGG - Intergenic
1029383180 7:100226562-100226584 GTCACCATGGTGACCAGAGCTGG - Intronic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1033597887 7:142869424-142869446 GACTCCAGAGTCAGCACAGCTGG + Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1035270698 7:157718389-157718411 GCCTCCAGCCTGACCTGTGCTGG - Intronic
1038349359 8:26762373-26762395 GCTTCCAGAGAGCCCAGGGCAGG - Intronic
1040794107 8:51271111-51271133 TCCTCAAGCGTGACCAGAGTGGG - Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041105947 8:54444188-54444210 GCCCACAGAGGGACCAAAGCTGG - Intergenic
1041381565 8:57258662-57258684 GGCTGCAGAGTGCCCAGCGCCGG + Intergenic
1041985014 8:63910880-63910902 GCTTCCAGAGTGTACAGAGAGGG - Intergenic
1044026174 8:87175315-87175337 CTCTCCAGAGTCACCACAGCTGG + Intronic
1046797499 8:118388841-118388863 GCCAACAGAGAGACCAGAGCTGG + Intronic
1048208070 8:132431444-132431466 ACCTCCCTAGAGACCAGAGCTGG - Intronic
1048296485 8:133218399-133218421 GCGTCCAAGGTGACCACAGCGGG - Intronic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1049107728 8:140624206-140624228 GGCTCCAGAGGGGGCAGAGCCGG - Intronic
1049606694 8:143532900-143532922 GCCGCCTGAGTGACCAGGCCAGG + Intronic
1049717252 8:144098853-144098875 GCCACCAGAGGTACCAGAGGTGG - Exonic
1053393326 9:37751765-37751787 TCCTCAAGCGTGGCCAGAGCGGG - Intronic
1053683155 9:40498656-40498678 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1053933133 9:43126972-43126994 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054280559 9:63126272-63126294 GCCTCCTCAGTGCCCAGATCTGG + Intergenic
1054296256 9:63334154-63334176 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054394272 9:64638659-64638681 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054428922 9:65143858-65143880 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054501458 9:65877677-65877699 GCCTCCTCAGTGCCCAGATCTGG + Intronic
1057305339 9:93909063-93909085 CCCCCCAGAGTGACCAGAGGTGG - Intergenic
1058580624 9:106452568-106452590 GGCTTCAGAGTGACCACATCTGG - Intergenic
1059409834 9:114124893-114124915 GCCTCCAGAGTGGGGAGGGCAGG - Intergenic
1059443363 9:114323390-114323412 GCCTCCAGAGTCCCCTGGGCTGG - Intronic
1059444552 9:114330161-114330183 GCCTCCAGAGTCCCCTGGGCTGG - Intronic
1060028243 9:120191390-120191412 GGCTCAAGAGTGACCACAGGTGG + Intergenic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062562194 9:137146576-137146598 GGCTGCAGAGAGATCAGAGCTGG + Intronic
1062595968 9:137299415-137299437 ACCTCCAGCGTGCCCAGAGCTGG - Intergenic
1203461948 Un_GL000220v1:49453-49475 GCCTCCAGTGTGGTCAGAGCAGG + Intergenic
1186611963 X:11146288-11146310 GCCGGCAAAGTGACCACAGCTGG + Intronic
1187391177 X:18887402-18887424 CTCCGCAGAGTGACCAGAGCCGG - Intergenic
1190651274 X:52571132-52571154 GCCTCCAGTGTGGTCGGAGCAGG + Intergenic
1192522616 X:71815312-71815334 AACTGCAGAGTGTCCAGAGCCGG - Intergenic
1192636402 X:72823720-72823742 GCCACCAGAGGGAACAGAACAGG - Intronic
1192645312 X:72897094-72897116 GCCACCAGAGGGAACAGAACAGG + Intronic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1195368546 X:104150371-104150393 TCCTCCAGAGTGATCAGCACTGG - Intronic
1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1196875700 X:120153477-120153499 GCCTCCGGTGTGGTCAGAGCAGG - Intergenic
1198469410 X:136932308-136932330 GCTGCCAGTGTGACTAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200180431 X:154147169-154147191 GCCACCAGTGTAACTAGAGCTGG - Intronic
1200186259 X:154185564-154185586 GCCACCAGTGTAACTAGAGCTGG - Intergenic
1200191911 X:154222702-154222724 GCCACCAGTGTAACTAGAGCTGG - Intronic
1200197666 X:154260506-154260528 GCCACCAGTGTAACTAGAGCTGG - Intronic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1200802526 Y:7399518-7399540 GCCACCATATTGACCATAGCTGG - Intergenic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202051952 Y:20790811-20790833 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic