ID: 1168006951

View in Genome Browser
Species Human (GRCh38)
Location 19:53497956-53497978
Sequence TGGACAATACCTGGCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168006951_1168006960 19 Left 1168006951 19:53497956-53497978 CCAGAAAAGCCAGGTATTGTCCA No data
Right 1168006960 19:53497998-53498020 AGCCTGAGATATGGCCTCGTGGG No data
1168006951_1168006959 18 Left 1168006951 19:53497956-53497978 CCAGAAAAGCCAGGTATTGTCCA No data
Right 1168006959 19:53497997-53498019 TAGCCTGAGATATGGCCTCGTGG No data
1168006951_1168006963 24 Left 1168006951 19:53497956-53497978 CCAGAAAAGCCAGGTATTGTCCA No data
Right 1168006963 19:53498003-53498025 GAGATATGGCCTCGTGGGAAGGG No data
1168006951_1168006962 23 Left 1168006951 19:53497956-53497978 CCAGAAAAGCCAGGTATTGTCCA No data
Right 1168006962 19:53498002-53498024 TGAGATATGGCCTCGTGGGAAGG No data
1168006951_1168006958 10 Left 1168006951 19:53497956-53497978 CCAGAAAAGCCAGGTATTGTCCA No data
Right 1168006958 19:53497989-53498011 CCATGTGATAGCCTGAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168006951 Original CRISPR TGGACAATACCTGGCTTTTC TGG (reversed) Intergenic