ID: 1168009439

View in Genome Browser
Species Human (GRCh38)
Location 19:53518896-53518918
Sequence CTGTGGCCATAAAAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168009439_1168009448 3 Left 1168009439 19:53518896-53518918 CCTTGCTCCTTTTATGGCCACAG No data
Right 1168009448 19:53518922-53518944 CCTCTGGGGAGGACAGATGGTGG No data
1168009439_1168009446 0 Left 1168009439 19:53518896-53518918 CCTTGCTCCTTTTATGGCCACAG No data
Right 1168009446 19:53518919-53518941 AGTCCTCTGGGGAGGACAGATGG No data
1168009439_1168009444 -8 Left 1168009439 19:53518896-53518918 CCTTGCTCCTTTTATGGCCACAG No data
Right 1168009444 19:53518911-53518933 GGCCACAGAGTCCTCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168009439 Original CRISPR CTGTGGCCATAAAAGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr