ID: 1168009888

View in Genome Browser
Species Human (GRCh38)
Location 19:53521567-53521589
Sequence TCTGTAGGGGTGACGCAGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168009882_1168009888 1 Left 1168009882 19:53521543-53521565 CCATAGCGCCGGGCTGTAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1168009888 19:53521567-53521589 TCTGTAGGGGTGACGCAGCCGGG 0: 1
1: 0
2: 1
3: 8
4: 104
1168009883_1168009888 -7 Left 1168009883 19:53521551-53521573 CCGGGCTGTAAGGGCATCTGTAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1168009888 19:53521567-53521589 TCTGTAGGGGTGACGCAGCCGGG 0: 1
1: 0
2: 1
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168009888 Original CRISPR TCTGTAGGGGTGACGCAGCC GGG Exonic