ID: 1168011025

View in Genome Browser
Species Human (GRCh38)
Location 19:53532410-53532432
Sequence CTGGATTTTCCTGGTTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 549}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168011021_1168011025 -4 Left 1168011021 19:53532391-53532413 CCCATGTTATCACAAATGACTGG 0: 1
1: 1
2: 17
3: 75
4: 355
Right 1168011025 19:53532410-53532432 CTGGATTTTCCTGGTTTTTAAGG 0: 1
1: 0
2: 1
3: 32
4: 549
1168011020_1168011025 8 Left 1168011020 19:53532379-53532401 CCTCTAGGTTCACCCATGTTATC 0: 1
1: 13
2: 101
3: 622
4: 1880
Right 1168011025 19:53532410-53532432 CTGGATTTTCCTGGTTTTTAAGG 0: 1
1: 0
2: 1
3: 32
4: 549
1168011023_1168011025 -5 Left 1168011023 19:53532392-53532414 CCATGTTATCACAAATGACTGGA 0: 1
1: 13
2: 201
3: 881
4: 2379
Right 1168011025 19:53532410-53532432 CTGGATTTTCCTGGTTTTTAAGG 0: 1
1: 0
2: 1
3: 32
4: 549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168011025 Original CRISPR CTGGATTTTCCTGGTTTTTA AGG Intronic
900499903 1:2999010-2999032 CAGGATTCTCCTTGCTTTTATGG + Intergenic
901181618 1:7346000-7346022 CTGGACTTCTCTGGTATTTAGGG - Intronic
902591444 1:17477842-17477864 CTTGATTTTTCTTGTTTTTTAGG + Intergenic
903290030 1:22305056-22305078 CAGGATTTTCCTATTTTTAAAGG - Intergenic
905508537 1:38500136-38500158 CTGGATTTTCCTTCTTTTACAGG + Intergenic
906914881 1:49997905-49997927 ATGTATTTTCATGGTTTTTGAGG - Intronic
908531064 1:65034681-65034703 CTGGTGTTTCATGGTTTGTATGG - Intergenic
908797250 1:67843118-67843140 ATGGTTTTTGCTTGTTTTTAAGG + Intergenic
909384347 1:75037682-75037704 CTGGATTTTCCTCATCTTTGTGG - Intergenic
909385427 1:75050001-75050023 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
909406378 1:75294695-75294717 CAGGATTTTCTTCTTTTTTAAGG - Intronic
909489340 1:76208819-76208841 TTGGATTTACCTGGATTCTAGGG + Intronic
909532605 1:76698861-76698883 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
909690024 1:78397350-78397372 CTGGTTTTTCCTTGTGTTTGTGG + Intronic
910177325 1:84444102-84444124 CTGGTTTTTCCTCATATTTATGG - Intergenic
910331116 1:86073005-86073027 CTGGTTTTTCCTGATCTTTGTGG - Intronic
910404414 1:86872187-86872209 CCGTATTTTCCTGATTTTGAAGG + Intronic
911345210 1:96688664-96688686 CTGAATTTTACTCCTTTTTAAGG + Intergenic
911632779 1:100200937-100200959 CTGGTTTTTCCTCATCTTTATGG - Intronic
912067994 1:105770671-105770693 TTGGATTTTACTGATTTCTATGG - Intergenic
912076925 1:105886293-105886315 ATAGATTTTCCTGGGTTTAATGG - Intergenic
915253226 1:154605432-154605454 CTGGATTTTTTTTTTTTTTATGG + Intronic
915688565 1:157662655-157662677 CTGGTTTTTCCTCGTCTTCATGG - Intergenic
916723649 1:167503911-167503933 CTGGTGTTTCCTGGTTTTCTGGG + Intronic
916786097 1:168088194-168088216 CTTTATTTCCCTGCTTTTTAGGG - Intronic
916842629 1:168615445-168615467 CTGGGTTTTCCTGCTTCTAAGGG + Intergenic
916957451 1:169853978-169854000 CTGATTTTTACTGGATTTTATGG - Exonic
917008525 1:170444309-170444331 TTGTATTTTCCTGTTTTCTATGG - Intergenic
917023259 1:170613640-170613662 CTGGATTTTCCTCATCTTCATGG + Intergenic
917239180 1:172929127-172929149 TAGGATTTCCCAGGTTTTTAAGG - Intergenic
917825867 1:178819612-178819634 CTGGATTCTCCTTAGTTTTAGGG + Intronic
917907751 1:179604667-179604689 ATGTATTTGCATGGTTTTTAAGG + Intronic
917938172 1:179890276-179890298 CTTCATTTTCCTTGTTTTTTTGG + Intronic
918791062 1:188829526-188829548 TTGCTTTTTCCAGGTTTTTAAGG - Intergenic
919821983 1:201479209-201479231 CTGAATTTTCATGGCCTTTAGGG + Intergenic
921176431 1:212599331-212599353 TTGGCTTTTCCTGGTTCTTGAGG + Intronic
921288589 1:213632574-213632596 CTAGATTCTCCTGGTTTTTGTGG - Intergenic
921997910 1:221441578-221441600 CAGGATTTTCTTCCTTTTTAAGG - Intergenic
922177673 1:223209288-223209310 GTGGATTTTCGGGGATTTTATGG - Intergenic
922383173 1:225053965-225053987 CTGTAATTTCCTGGTTCTTTAGG - Intronic
924465561 1:244296270-244296292 CTGACTTTTCCTGGGATTTATGG - Intergenic
924602927 1:245507317-245507339 CTGCATCCTCCTGGTTTCTACGG - Intronic
1063566572 10:7176580-7176602 CTGAATTTGCATGGTTTTCAAGG - Intronic
1063713247 10:8501476-8501498 TTTGGTTTTCCTGTTTTTTAGGG - Intergenic
1064552156 10:16513945-16513967 CTGGAATTTTCTGGATTTGAGGG - Exonic
1065351596 10:24800500-24800522 CTAGATTTTCCAGGTGTCTAGGG - Intergenic
1066036006 10:31484680-31484702 CTGGTTATTCTTAGTTTTTACGG + Intronic
1066242014 10:33546915-33546937 ATGTATTTTACTGGTATTTATGG + Intergenic
1067684965 10:48460804-48460826 CTGAATTTCCCTCCTTTTTAAGG - Intronic
1067932293 10:50575004-50575026 TTGAATTTTCCTCTTTTTTAAGG - Intronic
1067977090 10:51038655-51038677 CTGGATCTTGCTCTTTTTTATGG + Intronic
1068482155 10:57605474-57605496 CTGTATTTTCTTGCTTTTTAAGG + Intergenic
1068643958 10:59444597-59444619 CAGGATTTTCCTATTTTTAAAGG - Intergenic
1068777568 10:60884651-60884673 CAGAATTTTCCTCTTTTTTAGGG - Intronic
1068879595 10:62034631-62034653 CTTGATTTGCCTTGTTTTTGTGG + Intronic
1068894845 10:62188041-62188063 CTATATTTTCATGCTTTTTAAGG + Intronic
1071092669 10:81937101-81937123 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1071484913 10:86093079-86093101 ATGGATTTGCATGGTTTTGAAGG - Intronic
1074330793 10:112506928-112506950 CTGTATTTTTTTGGTTTTTATGG + Intronic
1074811526 10:117110032-117110054 CTGGATTCTGCTGGTAGTTAAGG + Intronic
1075165921 10:120068273-120068295 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1075168773 10:120093702-120093724 CAGGATTTTCTTTCTTTTTAAGG + Intergenic
1075947040 10:126442858-126442880 ATGTATTTTCATGGTTTTAAAGG - Intronic
1076341575 10:129751023-129751045 CTGACTTTTTCTGGTTTTGATGG + Intronic
1077285200 11:1762498-1762520 CTGGCTTTTCCTGGCTTGTCAGG + Intronic
1077586407 11:3457131-3457153 CTGGGTTTTCCTTCTGTTTATGG + Intergenic
1077659069 11:4050629-4050651 CTGTATTTTCCTGGAATTTTAGG - Intronic
1077775030 11:5261201-5261223 CTGTATTTGCATGGTTTTGAAGG - Intronic
1078690302 11:13573274-13573296 CTGGATTTTTTTGGTTGGTAGGG - Intergenic
1078882907 11:15470452-15470474 CAGGATTTTCTTCATTTTTAAGG + Intergenic
1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG + Intergenic
1079649084 11:22904108-22904130 CAGGATTTTCTTTTTTTTTAAGG + Intergenic
1079946855 11:26754112-26754134 CTGGATTTTGTTTATTTTTAGGG + Intergenic
1080152790 11:29073826-29073848 GTGTATTTTCATGGTTTTGAAGG + Intergenic
1080217475 11:29861807-29861829 GTGGATCTTCCTATTTTTTAGGG - Intergenic
1081015383 11:37871613-37871635 CAGGATTTTCTTTATTTTTATGG - Intergenic
1081887758 11:46513801-46513823 CTGGCTTTTCCTATTTTTTAAGG + Intronic
1082210306 11:49492648-49492670 TTGGCTTTTCGTGGTTTTTCTGG + Intergenic
1082253182 11:50004587-50004609 ATGTATTTGCCTGGTTTTGAGGG - Intergenic
1082623213 11:55450147-55450169 CAGGATCTTCCTCTTTTTTAAGG - Intergenic
1083507140 11:63168196-63168218 CTGGTTTTTCCTCATCTTTATGG - Intronic
1085240302 11:75047739-75047761 ATGTATTTGCCTGGTTTTGAGGG + Intergenic
1085384806 11:76151306-76151328 TTGCATTTTCCTGGTGTTAAAGG - Intergenic
1086113311 11:83221500-83221522 CTGGCTTCTTTTGGTTTTTATGG + Intronic
1086198649 11:84173169-84173191 CTGGATTTGCCTGATTTGGAAGG + Intronic
1086648436 11:89255105-89255127 ATGTATTTGCCTGGTTTTGAAGG + Intronic
1087994680 11:104789507-104789529 CAGGAATTTCATCGTTTTTATGG - Intergenic
1088457931 11:110051781-110051803 CTTTATAGTCCTGGTTTTTATGG - Intergenic
1089768862 11:120788391-120788413 CTGGATGTTCCTGGCCTTTTTGG - Intronic
1090559255 11:127912796-127912818 ATGCATTTGCATGGTTTTTAAGG + Intergenic
1093210550 12:16303098-16303120 CTTGTTTTTTCTGTTTTTTACGG - Intergenic
1094073840 12:26450712-26450734 CTGGATATTCCTGGTGGTTCTGG - Intronic
1094741959 12:33299954-33299976 CTGCATTTTCCTCTTTTTTTTGG - Intergenic
1094757975 12:33493601-33493623 CTGGTTTTTCCTCATCTTTATGG - Intergenic
1095134262 12:38579496-38579518 CTGGATCTTGCTCTTTTTTATGG - Intergenic
1095778999 12:46037881-46037903 CTGGTTTTTCCTCATCTTTATGG - Intergenic
1096032106 12:48428019-48428041 ATGTATTTTCATGGTTTTGAAGG - Intergenic
1096350440 12:50894693-50894715 CAGGATTTTCTTACTTTTTAAGG - Intergenic
1096430084 12:51535717-51535739 TTGGATTTTGGTAGTTTTTATGG + Intergenic
1097730693 12:63124782-63124804 CTGAAATTTCTTGGTTTTTATGG - Intergenic
1098420191 12:70288063-70288085 CTTGATGTTCCTGTTATTTATGG - Intronic
1098645354 12:72893904-72893926 CTGGATTTAACTGCTTTTTCTGG + Intergenic
1099203048 12:79697598-79697620 CTGGATTTTTGTGATATTTATGG - Intergenic
1099463570 12:82954544-82954566 CAGTATTTCCCTGGTTTTGAAGG + Intronic
1099882976 12:88490802-88490824 CTATAATTTCCTGGTTATTATGG + Intergenic
1100055283 12:90501997-90502019 CTAGAGTTTTGTGGTTTTTAAGG + Intergenic
1100230958 12:92607027-92607049 CTGGATTTTACTGTTTGTAAAGG - Intergenic
1100592647 12:96043895-96043917 CTACATTTTCCTGGTTTATCAGG - Intergenic
1100721718 12:97366041-97366063 CTGGAATTTGCTGGTTTTGGTGG + Intergenic
1101067380 12:101036514-101036536 CAGGATTTTCTTCTTTTTTATGG - Intronic
1101116267 12:101534515-101534537 CAGGATTTTCTTATTTTTTACGG - Intergenic
1101954717 12:109203184-109203206 CAGAATTTCCCTGTTTTTTAAGG + Intronic
1102254575 12:111408132-111408154 CTGGAATTTCCTGGGTCTTTGGG + Intronic
1102753515 12:115317546-115317568 CAGGATTTTCTTGCTTTTTAAGG - Intergenic
1103033725 12:117639782-117639804 CTTGATCTTCCTGGTATTGACGG - Intronic
1103941520 12:124503827-124503849 CTTCATTTTCCGGGTTTTTCTGG + Intronic
1104105778 12:125657651-125657673 CTGGATTTTCCAGGATTTTATGG + Exonic
1105401553 13:20100616-20100638 CAGGATTTCCCTCCTTTTTAAGG - Intergenic
1105416768 13:20220182-20220204 CAGGATTTTCTTCCTTTTTAAGG - Intergenic
1105688195 13:22807253-22807275 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1106061744 13:26299795-26299817 CAGTAGTTTCCTGCTTTTTAAGG + Intronic
1106193719 13:27475930-27475952 CAGGATTTCCTTTGTTTTTAAGG + Intergenic
1106197180 13:27503910-27503932 CTGGCTTTTACAGGTCTTTACGG - Intergenic
1106334966 13:28776005-28776027 CTGGTTTTTCCTCATTTTTGTGG + Intergenic
1106539580 13:30677988-30678010 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1106622381 13:31383171-31383193 CAGGATTTCCCTCTTTTTTAAGG + Intergenic
1106913730 13:34489652-34489674 CTGGATTTTCTTCCCTTTTAAGG + Intergenic
1107332411 13:39315674-39315696 CAGGATTTACCCTGTTTTTAAGG + Intergenic
1108444083 13:50488901-50488923 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1109125370 13:58510963-58510985 ATGTATTTTCATGGTTTTGAAGG - Intergenic
1109201118 13:59432474-59432496 ATGTATTTTCATGGTTTTGAGGG + Intergenic
1109443973 13:62408571-62408593 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1109497622 13:63194496-63194518 CTGGAATTTCCTTGTGTTTATGG - Intergenic
1109902686 13:68794994-68795016 CTGGATTTTCCTTATCTTCATGG + Intergenic
1111184009 13:84705655-84705677 CTGTATTATCATAGTTTTTAAGG - Intergenic
1111340689 13:86882006-86882028 TTTGATTTTGCTGGTTTTTCTGG + Intergenic
1111780069 13:92711989-92712011 CTTCTTTTTCCAGGTTTTTAAGG - Intronic
1112251955 13:97789896-97789918 ATTTATTTTCCTAGTTTTTAAGG + Intergenic
1112546398 13:100375952-100375974 CTGGTTTTTCCTCATCTTTATGG + Intronic
1113371274 13:109727727-109727749 CTGGAGTTTCCTGGAAGTTAGGG - Intergenic
1114133431 14:19819796-19819818 CTGGTTTTTCCTCATCTTTATGG + Intronic
1115868468 14:37774326-37774348 TTGTCTTTTTCTGGTTTTTAAGG + Intronic
1116215303 14:42009677-42009699 CTGCATTTGCCTAATTTTTATGG + Intergenic
1116312215 14:43341755-43341777 CTGGATTTTCCTCATCTTCATGG + Intergenic
1116671724 14:47850817-47850839 CTGGTTTTTGCTTGTTTTGATGG - Intergenic
1116765273 14:49062787-49062809 CTGGTTTTTCCTCATCTTTATGG - Intergenic
1116826679 14:49679521-49679543 CTGGTTTTTCCTGGGATTTGAGG - Intronic
1117318587 14:54598653-54598675 CTGTATTTTTCTGGTTTTAAAGG + Intronic
1117509895 14:56440366-56440388 ATGTATTTGCCTGGTTTTGAAGG + Intergenic
1118165854 14:63335261-63335283 ATGGATTTGCATGGTTTTGAAGG - Intergenic
1118965136 14:70574852-70574874 CAGGATTTTCTTATTTTTTAAGG - Intergenic
1120014472 14:79454642-79454664 CTCTATTTTCCTGATTTTAATGG + Intronic
1120148098 14:81001746-81001768 CTTGATTTGCCTGATTTTGAGGG + Intronic
1120148280 14:81003593-81003615 CTTGATTTGCCTGATTTTGAGGG + Intronic
1121854192 14:97251579-97251601 CTGGTGTTTCCTGTTTTTTCAGG + Intergenic
1121957158 14:98225104-98225126 CTAGATTTTGGTGGTTATTACGG + Intergenic
1124055964 15:26241271-26241293 CTGGATTTTGCTGGTATCTTTGG - Intergenic
1124056319 15:26243844-26243866 CTTGATTTTCATTGTTTTGATGG + Intergenic
1124111390 15:26792306-26792328 CTTTATTTTCCTGGTATTTTAGG + Intronic
1124830884 15:33148350-33148372 CAGTATTTTCCTGTTCTTTATGG + Intronic
1125381572 15:39092305-39092327 CTGGATTTTACGGGCTTTTGTGG + Intergenic
1125408490 15:39380035-39380057 TTGTTTTTTTCTGGTTTTTAAGG - Intergenic
1126577775 15:50213658-50213680 CTGTATTTGCATGGTTTTGAAGG - Intronic
1126814801 15:52443982-52444004 CTTGATTTTCCTTTTTTTTTTGG - Intronic
1126990610 15:54371760-54371782 CAGGATTTCCCTCTTTTTTAAGG - Intronic
1127573727 15:60269959-60269981 ATGAATTTTCATGGTTTTGAGGG + Intergenic
1129809425 15:78495996-78496018 CTGGATCTTACTGCTTTGTATGG + Intronic
1130446942 15:84011689-84011711 ATTGATTTTCTTGTTTTTTAAGG - Intronic
1130474771 15:84254856-84254878 CTGGTTTTCCGTGGTTTTCATGG + Intergenic
1130482187 15:84368912-84368934 CTGGTTTTCCGTGGTTTTCATGG + Intergenic
1131314942 15:91327980-91328002 CTGGATTGTCTTGGTGCTTATGG + Intergenic
1131862637 15:96670511-96670533 CTGCATTTTACTGGTTCTCATGG + Intergenic
1132254000 15:100358402-100358424 ATGTATTTGCCTGGTTTTGATGG - Intergenic
1133143804 16:3768739-3768761 TTGCAATTTCCTGATTTTTAAGG + Intronic
1133405145 16:5518152-5518174 TTGGATTTTATTGGTTTTTTAGG - Intergenic
1133541316 16:6757268-6757290 TGGGATTTTGCTGGATTTTATGG - Intronic
1134208366 16:12255703-12255725 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1136028236 16:27483859-27483881 CTGGCTTTTCCTGCTGTTTTTGG - Intronic
1136926377 16:34378599-34378621 CTGCATTTTCATAGTTTGTATGG - Intergenic
1136978197 16:35033208-35033230 CTGCATTTTCATAGTTTGTATGG + Intergenic
1140449799 16:75061556-75061578 CTGGATCTCACTCGTTTTTATGG + Intronic
1141129479 16:81425735-81425757 CTGAATTTCCCTCCTTTTTATGG - Intergenic
1141209274 16:81961069-81961091 ATGGATTTTCCAAGTTTTTCTGG + Exonic
1141245999 16:82308524-82308546 CTGGTTTTTCCTTGTCTTCATGG + Intergenic
1141478419 16:84289524-84289546 CATGATTTTGCTGTTTTTTATGG + Intergenic
1143830706 17:9648198-9648220 CTGGAATTTCCTGGGATTTTTGG + Intronic
1146553961 17:33807092-33807114 CTGCATTTTCCTGGAGTGTAGGG - Intronic
1147678454 17:42223611-42223633 CTGGCTTTTCCTGGGGATTAAGG - Intronic
1148994612 17:51698878-51698900 CAGGATTTCCTTTGTTTTTAAGG + Intronic
1149949024 17:60964667-60964689 TGGGATTTTCTTGCTTTTTATGG + Intronic
1151288423 17:73130596-73130618 ATGGATTTTCCTCCTTTTTAAGG - Intergenic
1153071284 18:1107603-1107625 CTTCAATTTCCTGATTTTTAAGG + Intergenic
1153167405 18:2278424-2278446 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1153594966 18:6715922-6715944 CTGCCCTTTCCTGGGTTTTAGGG - Intergenic
1154078760 18:11233554-11233576 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1154134225 18:11761618-11761640 CTGGATTTTGCAGATTTCTATGG + Intronic
1154295806 18:13146318-13146340 CCGGATTTTCCTCTTTTTGAAGG - Intergenic
1154525008 18:15278301-15278323 CTGGATTTTCTTAGCTATTAAGG + Intergenic
1155140877 18:23043526-23043548 CTGAATTTTCTTCCTTTTTAAGG - Intergenic
1155176189 18:23303284-23303306 TTGGAATTTCCTGATTTTTGAGG - Intronic
1155186734 18:23393570-23393592 CAGGATTTTCTTCCTTTTTAAGG + Intronic
1156289068 18:35729557-35729579 CTTGATTTTGCTCCTTTTTATGG - Intergenic
1157306280 18:46519942-46519964 CTGGATTTTCCTGGACTAAAGGG + Intronic
1157316706 18:46596338-46596360 CTGAATTTTGCTGGTTCTTATGG - Intronic
1157757204 18:50229408-50229430 CAGGATTTCCTTGCTTTTTAAGG + Intronic
1158294860 18:55984677-55984699 CTGGGTTTTACTGGTTTCTTGGG - Intergenic
1158751812 18:60270868-60270890 CTGGATATGCTTGGTTTTGAAGG + Intergenic
1159313348 18:66738332-66738354 CTAGGTTTTCTTGGTTTTTATGG + Intergenic
1159430653 18:68348612-68348634 TTGTATTTTCATGGTTTTGAAGG - Intergenic
1159665953 18:71160393-71160415 CTGAATTTTTCTGGTTATTTAGG - Intergenic
1159884795 18:73893730-73893752 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1160069719 18:75616237-75616259 CAGGATTTTCTTCATTTTTAGGG - Intergenic
1160558381 18:79740395-79740417 CTGGAAGTCCCTGGTCTTTAAGG - Intronic
1161412722 19:4125392-4125414 CAGGATTTTCCTCCTTTTTAAGG + Intergenic
1161739303 19:6010699-6010721 TTGGAATTTCCTCCTTTTTAAGG + Intronic
1161978412 19:7618544-7618566 CTGGATTCTCCTGGTCTGTGTGG + Intergenic
1162505632 19:11082847-11082869 CCTGAATTTCCTTGTTTTTAAGG + Intergenic
1162709864 19:12584792-12584814 CTGGATTTGCATGGTTCTAATGG - Intronic
1162809949 19:13157989-13158011 GTGGGTTTTTCTGGTTTTTTGGG + Intergenic
1163908005 19:20164286-20164308 ATGGATTTGCATGGTTTTGAGGG - Intergenic
1164102841 19:22073847-22073869 CTGCTTTTTCATTGTTTTTAGGG + Intronic
1164107889 19:22125032-22125054 GTGGATTTTCTTGGCTTTTCTGG - Intergenic
1164804211 19:31103778-31103800 CAGGCTTGTCCTGGATTTTAGGG - Intergenic
1165141936 19:33704952-33704974 GTGGATTCTCCTGATTTTAAAGG + Intronic
1165449245 19:35872657-35872679 GAGGAATTTCCTGGTATTTAGGG - Intronic
1165716091 19:38046674-38046696 CTGGATTTTCCGGGTGTGGAGGG + Intronic
1168011025 19:53532410-53532432 CTGGATTTTCCTGGTTTTTAAGG + Intronic
925259297 2:2516141-2516163 CTGGATTGTGCCAGTTTTTAAGG - Intergenic
925323783 2:2999314-2999336 CTGAATCTTCATGCTTTTTAAGG - Intergenic
925475684 2:4211632-4211654 CAGGATTTTCTTCTTTTTTAGGG + Intergenic
925743894 2:7028967-7028989 CTTGAGTTTCCTGATTTTTGGGG - Intronic
925925855 2:8669791-8669813 CTGCACTTGGCTGGTTTTTATGG - Intergenic
926265557 2:11316258-11316280 CTGAATTTTCTTGGTCTCTAAGG - Intronic
927036481 2:19182748-19182770 ATGTATTTTCATGGTTTTCAGGG + Intergenic
927429058 2:23011511-23011533 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
927517138 2:23678728-23678750 CAGGATTTCCCTCCTTTTTAAGG - Intronic
927758159 2:25725365-25725387 CTGGGTTTTTCTGTTATTTATGG - Intergenic
928609057 2:32973924-32973946 CTGGATTTTATTCTTTTTTATGG + Intronic
929678669 2:43966122-43966144 CAGGATTTTCTTTGTTTTTAAGG - Intronic
929963766 2:46518163-46518185 CAGGATTTTCTTCCTTTTTAAGG - Intronic
930889443 2:56366082-56366104 CAGGATTTCCTTCGTTTTTAAGG + Intronic
931074080 2:58689522-58689544 CTGGCTTTTCCTCGTCTTCATGG - Intergenic
931297374 2:60941409-60941431 CTGAAGTTTCTTGGTTTCTAGGG - Intronic
931337067 2:61356528-61356550 CAGCATTTTCTTCGTTTTTAAGG - Intronic
931772924 2:65514613-65514635 TAGGATTTTACTGGTTTTCATGG + Intergenic
931971223 2:67589175-67589197 CTGGAATTTCCTGATTTTCCAGG - Intergenic
932634910 2:73379544-73379566 CTGGATTTTCCAGACATTTAAGG + Intergenic
932685139 2:73862702-73862724 TTGGATTTTCCTGTGGTTTATGG + Exonic
933102994 2:78283824-78283846 CTGCATTTTCCTTGGATTTATGG - Intergenic
933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG + Intergenic
933547583 2:83734755-83734777 CATGATTTTCCTGATTTATATGG + Intergenic
934874322 2:97901600-97901622 CAGGATTTTATTGTTTTTTATGG - Intronic
935311581 2:101788931-101788953 GTGGATTTTCTTGATTTGTAGGG + Intronic
935534268 2:104274583-104274605 GTGGATTTTCCTGGAGTTTTAGG - Intergenic
936409943 2:112248892-112248914 CTGAATTTTCCTTTTTTATAAGG - Intronic
936494987 2:113011045-113011067 CTGGATTTTCTTCTTTTTAAAGG + Intergenic
936878189 2:117217569-117217591 CTGGACTTACCTGATTTCTATGG - Intergenic
937829795 2:126407019-126407041 CAGGATTTTCTTACTTTTTAAGG + Intergenic
938008332 2:127807598-127807620 TTGGATTTAGCTGGATTTTAAGG + Intronic
938691435 2:133793215-133793237 CAGGATTTTCTTGGCTTTGATGG + Intergenic
940491644 2:154369535-154369557 CTGGATTCTCTTGGGTTCTATGG + Intronic
941102700 2:161313668-161313690 CTGTATTTTCTTGGTTTTGAAGG + Intronic
941860620 2:170275721-170275743 ACAGATTTTACTGGTTTTTATGG - Intronic
941917306 2:170821308-170821330 CTGGATTTTCCTTCTTTTCCAGG - Intronic
942726324 2:179011822-179011844 ATGTATTTTCATGGTTTTGAAGG - Intronic
942748005 2:179257777-179257799 CTGGGTTTTCCTTTTTGTTATGG - Intronic
943415608 2:187599023-187599045 TTGGATTTACCTGGATTCTAGGG - Intergenic
943596875 2:189868806-189868828 CTTGATTTTTGTGATTTTTAAGG + Intronic
944292157 2:198019262-198019284 CTGGATTTTCCTCATCTTCATGG - Intronic
944696294 2:202203109-202203131 CTGGATTTACGTGGTTCTGAAGG - Intergenic
944935438 2:204562243-204562265 CTGGAGCTTCCTGATGTTTATGG + Intronic
945346149 2:208719376-208719398 GTAGAATTTCCTTGTTTTTATGG + Intronic
945363813 2:208926492-208926514 ATGGAATTTCCTTCTTTTTAAGG - Intergenic
945895256 2:215474102-215474124 CTGCATTTTCATGGTTATTTGGG - Intergenic
946098671 2:217299734-217299756 CTGGATTATTCTGGTTTCAATGG + Intronic
946629475 2:221650962-221650984 CTGTATTTTCCTCTTTTTAAGGG - Intergenic
947997497 2:234540961-234540983 CAGGATTTCCCTCATTTTTAAGG - Intergenic
948713692 2:239843714-239843736 CAGGCTTTTGGTGGTTTTTAGGG + Intergenic
1169021895 20:2336460-2336482 CTGGCTCTTCCTGGTTTCTGGGG - Intronic
1169319928 20:4624432-4624454 CTGGATTTTCCTCATCTTCATGG + Intergenic
1169777934 20:9276443-9276465 CTGGATTTTACTGAGTTTTCAGG + Intronic
1170124955 20:12952414-12952436 ATGTATTTTCATGGTTTTGAAGG + Intergenic
1170179106 20:13509170-13509192 CAGGATTTTCTTGGTTTTAAAGG - Intronic
1170241872 20:14175081-14175103 CTGGATTCTCTTGGTTTTCCTGG + Intronic
1170291079 20:14768836-14768858 CTGGAATTTTCTGATCTTTATGG - Intronic
1171950809 20:31420076-31420098 CAGGATTTTCTTCTTTTTTATGG - Intergenic
1172533564 20:35653002-35653024 CTGGATGTTCCGGGTTTTGGAGG - Exonic
1173359485 20:42328999-42329021 CTGGTTTTTGCTGGTATTTAGGG - Intronic
1174894853 20:54437379-54437401 GTGGATTGTCCAGGTTCTTAAGG + Intergenic
1176383589 21:6126121-6126143 CTCGAGGTTCCTGGTTTCTAAGG - Intergenic
1176712834 21:10169410-10169432 ATGGATTTGTCTAGTTTTTAAGG - Intergenic
1176997372 21:15571220-15571242 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1177384169 21:20387693-20387715 ATAGAATTTCTTGGTTTTTAGGG - Intergenic
1177820270 21:26023535-26023557 CTGGTTTTTGTTTGTTTTTAAGG - Intronic
1177822364 21:26045435-26045457 CTGTATTTTCCCAGTTTTGAAGG - Intronic
1178081382 21:29069558-29069580 CTAGATTTTCCTGGGTATTTGGG - Intronic
1178223906 21:30692491-30692513 CAGGATTTTCTTCCTTTTTAAGG + Intergenic
1179362584 21:40726441-40726463 ATGGATTTACCTTGATTTTATGG - Intronic
1179520133 21:41937770-41937792 CAGGATTTTCTTCATTTTTAAGG - Intronic
1179739881 21:43412117-43412139 CTCGAGGTTCCTGGTTTCTAAGG + Intergenic
1181320478 22:22001873-22001895 CAGAATTTTCCTCCTTTTTAAGG - Intergenic
1182664809 22:31950044-31950066 CTGGATTTTGCTTGTTCTGAAGG + Intronic
1183021375 22:35030058-35030080 CTGGTTTTTCCTCGCCTTTATGG + Intergenic
1184910956 22:47533793-47533815 CTGGATTTTCATTTTTATTATGG + Intergenic
949173756 3:1034238-1034260 CTGGTTTTTCCTCATTTTCATGG + Intergenic
949189861 3:1238789-1238811 ATGTATTTGCCTGGTTTTGAAGG - Intronic
949521579 3:4859989-4860011 CAGGATTTTCTTCCTTTTTAAGG - Intronic
949603333 3:5625872-5625894 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
949799393 3:7886746-7886768 ATGTATTTGCCTGGTTTTGAGGG - Intergenic
951198399 3:19850225-19850247 ATGTATTTTCCTGATTTTGAGGG - Intergenic
951905565 3:27703477-27703499 CTGGATTCTCTTGGTCTCTACGG + Intergenic
952159685 3:30681284-30681306 CTTCATTTTCCTGGATTTCAAGG + Intronic
952245894 3:31592283-31592305 CAGGATTTTCTTCCTTTTTAAGG + Intronic
953337874 3:42109304-42109326 CTGGATTTTATTGGGTTTGATGG - Intronic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
953447615 3:42980959-42980981 CTGGAGTCTCCTGGCTTTAAAGG + Intronic
953833050 3:46318609-46318631 CAGAATTTTCTTTGTTTTTAAGG + Intergenic
954479918 3:50789268-50789290 ATGTATTTTCATGGTTTTGAGGG + Intronic
954589552 3:51770675-51770697 CTGTATTTTTGTGTTTTTTATGG + Intergenic
955008885 3:54995330-54995352 TTGGATTTTCCTGTTATTTGTGG - Intronic
955107582 3:55913485-55913507 CTGGATTTTTGTGGTTTTTCAGG - Intronic
955205815 3:56895052-56895074 CTGCATGTCCCTGGTGTTTAGGG + Intronic
956450474 3:69370134-69370156 TTGGATTTTCCTGGATTCTTAGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957130644 3:76219192-76219214 ATGGTTTTACATGGTTTTTAAGG - Intronic
957462894 3:80545329-80545351 CTTGATTTTCCTATCTTTTAAGG + Intergenic
958010408 3:87871157-87871179 CATTATTTTCCTGATTTTTAAGG - Intergenic
958770905 3:98424404-98424426 ATGCATTTGCCTGGTTTTGAAGG - Intergenic
959566426 3:107837111-107837133 CAGGATTTCCTTGTTTTTTAAGG + Intergenic
959735095 3:109648919-109648941 CTGGTTTTTCCTCATTTTTGTGG - Intergenic
959828891 3:110835958-110835980 CTGGTTTTTCCTCATTTTCATGG + Intergenic
960099917 3:113730391-113730413 CTTCATTTTCCTGCCTTTTATGG + Intronic
960528498 3:118737287-118737309 CAGCATTTTCCTGGGTTTCAAGG + Intergenic
960996085 3:123341293-123341315 CAGGATTTTCTTCCTTTTTAAGG - Intronic
961500961 3:127335609-127335631 CAGGATTTTCTTCTTTTTTAGGG - Intergenic
962027443 3:131563245-131563267 CTTTATTTTCCTGGTTTGAAAGG + Intronic
962674099 3:137740482-137740504 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
963033892 3:141008003-141008025 CTCCATTTTCCTTGTTTATAAGG - Intergenic
963551228 3:146726498-146726520 CTGGTTTTTCCTCGTCTTCATGG - Intergenic
963805651 3:149719125-149719147 CTGAATTTTCTTCCTTTTTAAGG + Intronic
963998446 3:151739106-151739128 CTGGTTTTTCCTCATTTTCATGG + Intronic
964080649 3:152751723-152751745 CAGGATTTCCTTGATTTTTAAGG - Intergenic
965216632 3:165872472-165872494 ATGTATTTTCATGGTTTTGAGGG + Intergenic
965408170 3:168296502-168296524 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
966103287 3:176302692-176302714 CTGAATTTTCTTCCTTTTTAAGG + Intergenic
966137890 3:176721140-176721162 CTGCATTTTACAGTTTTTTAGGG + Intergenic
966309545 3:178577397-178577419 CTGGTTTTTCCTCATCTTTATGG - Intronic
967447891 3:189588246-189588268 CTGGATTTACATGGCTTGTAAGG - Intergenic
967563134 3:190940878-190940900 TTGGAATTTGCTGGTTATTAAGG - Intergenic
967790506 3:193543667-193543689 CTATTTTTTCCTGGTTGTTAGGG - Intronic
968828977 4:2922248-2922270 CTGGTTTTTCCTCGTCTTTGTGG + Intronic
969153591 4:5191138-5191160 CTGGTTTTCCCTGGTTTCCATGG + Intronic
969710087 4:8837819-8837841 ATCAATTTTCCTGGTTTTAAAGG - Intergenic
970993214 4:22236643-22236665 CTGGCTTCACCTGGTTTTAATGG + Intergenic
971124405 4:23737040-23737062 CAAGATGCTCCTGGTTTTTAGGG - Intergenic
971447866 4:26771487-26771509 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
973578741 4:52319706-52319728 CTGGATTTTGTTCCTTTTTATGG + Intergenic
973884415 4:55306234-55306256 CTGCACTTTCCTAGTTTTTTGGG + Intergenic
973984910 4:56341328-56341350 CATGATTTCCTTGGTTTTTATGG - Intronic
974302179 4:60082315-60082337 CTGGTTTTTCCTCATTTTCATGG - Intergenic
974470103 4:62308608-62308630 CTGGATCTTACTCATTTTTAGGG - Intergenic
974646417 4:64699123-64699145 CTGGATCTACCAGGATTTTACGG - Intergenic
975233882 4:71968741-71968763 TTGGATTTGGCTGGTTTATAAGG - Intergenic
976156676 4:82152975-82152997 CTGGTTTTTCCTCATCTTTATGG - Intergenic
976556437 4:86456005-86456027 ATGTATTTGCCTGGTTTTGAAGG - Intronic
978980192 4:114935432-114935454 TTGGATTTTCTTGGTTGCTAAGG + Intronic
980276004 4:130651404-130651426 CTGGTTTTTCCTCATCTTTATGG - Intergenic
980443308 4:132875243-132875265 CTGGATTTCACTCTTTTTTATGG - Intergenic
980554698 4:134387935-134387957 CTTGATTATCCTGGCTTTTTTGG - Intergenic
981981748 4:150801202-150801224 CCATATTTTCCTGGTTTTGAAGG + Intronic
981990174 4:150909448-150909470 CAGGATTTCCTTGTTTTTTAAGG + Intronic
982451296 4:155555145-155555167 ATGTATTTTCATGGTTTTGAGGG - Intergenic
982794420 4:159628839-159628861 CTGGATTTTCCTCATCTTCATGG + Intergenic
983022452 4:162694936-162694958 CAGGATTTTACTGTTTTTTATGG + Intergenic
983409389 4:167377578-167377600 CTGGATTTTCATTTTTTTTATGG - Intergenic
984144115 4:176040354-176040376 TTGTATTGTGCTGGTTTTTAAGG + Intergenic
984492159 4:180448491-180448513 CTGGACTTTCCTGTTTTTTTTGG + Intergenic
985032273 4:185801201-185801223 CAGGATTTTCTTCTTTTTTAGGG + Intronic
985326546 4:188776746-188776768 GTGGATTCTCCTGGCTTTTCTGG + Intergenic
986004351 5:3655772-3655794 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
986115151 5:4766498-4766520 CTTGGTTTTCCTGGATTTTCAGG + Intergenic
986957578 5:13172711-13172733 CAGGATTTCCTTGGTTTTTAAGG + Intergenic
987115457 5:14723061-14723083 TTAGACTTTCCTTGTTTTTAAGG - Intronic
987530387 5:19111382-19111404 CTGTTTTCTCCTGGTTTATATGG + Intergenic
987846491 5:23293915-23293937 ATGTATTTTCATGGTTTTGAGGG + Intergenic
988095117 5:26597181-26597203 CAGAATTTTCTTTGTTTTTAAGG + Intergenic
988135024 5:27159214-27159236 CTGGATGTTCTTGGTGCTTATGG + Intergenic
988272148 5:29031280-29031302 CTGGATTTTCCTAGATGTCAAGG + Intergenic
988623418 5:32846531-32846553 CTGAATTTACCTGGGTTTAAGGG - Intergenic
988627908 5:32897990-32898012 CTGGTTTTTCCTCATTTTTGTGG + Intergenic
989139088 5:38184738-38184760 TTAGAATTTCCTGGGTTTTATGG - Intergenic
989364058 5:40635485-40635507 CTGGTTTTTCCTTATTTTCATGG - Intergenic
989650417 5:43682510-43682532 CAGGATTTTCCTGTTTTTCATGG + Intronic
990657666 5:57975334-57975356 CTTTATTTTCCTGTTTTATAAGG - Intergenic
990898805 5:60728392-60728414 ATGTATTTTCATGGTTTTGAAGG + Intergenic
991463200 5:66881256-66881278 TTGGTTTTTCTGGGTTTTTAAGG + Intronic
991654332 5:68888318-68888340 CAGGATTTTCTTCCTTTTTAAGG - Intergenic
992383724 5:76264545-76264567 CTGGTTTTTCCTTGTCTTCATGG + Intronic
992637546 5:78739363-78739385 CTGGATTCTACTTGTTTTTCTGG - Intronic
993135875 5:83963360-83963382 CTGTATTTTTCTTTTTTTTAAGG - Exonic
993577006 5:89614392-89614414 CTGGCTTTTCCTGTTTGTCATGG - Intergenic
993661487 5:90642564-90642586 CTGAATTTTGCAGGCTTTTAAGG - Intronic
993911670 5:93691054-93691076 CTGGTTTTTCCTCATCTTTATGG - Intronic
994316053 5:98334564-98334586 CAGGATTTTCTTCTTTTTTATGG + Intergenic
994527346 5:100923168-100923190 ATGTATTTTCATGGTTTTGAAGG + Intergenic
994642075 5:102422151-102422173 CTGGTTTTTCCTCATCTTTATGG - Intronic
994802396 5:104395791-104395813 CTGGTTTTTCCTCATATTTATGG - Intergenic
994875555 5:105416256-105416278 ATGTATTTTCATGGTTTTGAAGG - Intergenic
995399015 5:111719597-111719619 CTGCATCTTCCTTGTTCTTATGG - Intronic
996279660 5:121713509-121713531 ATGTATTTTCTTGGTTTTAAGGG - Intergenic
996585075 5:125078388-125078410 CAGGATTTCCCTCTTTTTTAAGG - Intergenic
997442410 5:133918202-133918224 TTGTATTTTCCAGGTGTTTAAGG - Intergenic
997588503 5:135058781-135058803 CTTGAGTTGCCTGGTTGTTAGGG + Intronic
998049067 5:139016108-139016130 CCCCATTTTTCTGGTTTTTAAGG - Intronic
998142602 5:139708669-139708691 CTGGCTTTTCCTGGTCTTTCAGG + Intergenic
998718443 5:144912951-144912973 CAGGATTTCCTTGATTTTTAAGG - Intergenic
999920592 5:156315384-156315406 CAGGATTTACCTTGTTTTTAAGG + Intronic
1000232220 5:159326734-159326756 TTGGTTTTCCCTGGTTTTTCTGG - Exonic
1000725824 5:164769723-164769745 TTAGATTTTCCTGCTTTTGAAGG - Intergenic
1003163093 6:3652787-3652809 CTGGATTTCCCTCCTTTTTAGGG + Intergenic
1003193163 6:3891841-3891863 CTGGATGTTTCTGTTTTTTGGGG - Intergenic
1003465189 6:6372945-6372967 GTGTATTTTCATGGTTTTGAGGG - Intergenic
1008135206 6:47768125-47768147 CAGAATTTTCCTCTTTTTTAAGG + Intergenic
1008176095 6:48270109-48270131 CTGGTTTTTCCTCGTCTTCATGG + Intergenic
1008540615 6:52543829-52543851 CTGGCATTTCCTGGTATTCAGGG + Intronic
1008590616 6:52990101-52990123 GGGGATTTGCCTGGGTTTTAAGG + Intronic
1009943539 6:70317542-70317564 CTGGGTTTTCCTATTTTCTAAGG - Intergenic
1010289242 6:74116194-74116216 CTGTGTTTTGCTTGTTTTTATGG + Intergenic
1010518135 6:76800108-76800130 ATGTATTTTCATGGTTTTGAGGG + Intergenic
1010522238 6:76851878-76851900 CAGGATTTTACTCTTTTTTAAGG - Intergenic
1011225412 6:85099740-85099762 ATGTATTTTCATGGTTTTGAGGG - Intergenic
1011541984 6:88440720-88440742 CAGGATTTTCTTCCTTTTTAAGG - Intergenic
1012150951 6:95751684-95751706 CTGGATTTTATTCTTTTTTATGG - Intergenic
1012214248 6:96561962-96561984 CTGTATTTTCCTTGTTTTATGGG - Intergenic
1012249522 6:96964197-96964219 CTGGATTTCCCTGGGCTGTAGGG + Intronic
1012256041 6:97033348-97033370 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1012402313 6:98852001-98852023 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1012419367 6:99046351-99046373 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1012505035 6:99935534-99935556 CAGGATTTTGTTGTTTTTTATGG + Intronic
1012543349 6:100389051-100389073 CTCTAGTTTCCTGGTTTGTAAGG - Exonic
1012706154 6:102534515-102534537 CAGGATTTTGCTCTTTTTTATGG - Intergenic
1012892340 6:104910717-104910739 CAGGATTTTCTTCTTTTTTATGG - Intergenic
1013534213 6:111048671-111048693 CAGAATTTTCCTCCTTTTTAAGG + Intergenic
1013705052 6:112823138-112823160 CAGGATTTTCTTCTTTTTTATGG + Intergenic
1013852403 6:114532228-114532250 ATGTATTTTCATGGTTTTGAAGG + Intergenic
1013856941 6:114584062-114584084 ATGTATTTTCATGGTTTTGAGGG - Intergenic
1013981579 6:116136261-116136283 CAGGATTTTCTTCTTTTTTAAGG + Intronic
1014347476 6:120292399-120292421 CAGGATTTTCCTTCTTTTTGTGG + Intergenic
1014589784 6:123249597-123249619 CATGATTTTACTGTTTTTTATGG - Intronic
1015333999 6:132014257-132014279 ATGTATTTTCCTGATTATTAGGG + Intergenic
1016855081 6:148660085-148660107 CAGGATTTTCTTCTTTTTTATGG - Intergenic
1018781548 6:167071796-167071818 ATGTATTTGCCTGGTTTTGAGGG + Intergenic
1019805516 7:3121130-3121152 CAGAATTTCCCTGCTTTTTAAGG - Intergenic
1020576821 7:9943590-9943612 CTTGATTTTGCTGGTGTTTCAGG + Intergenic
1020694154 7:11393390-11393412 CTGGTTTTTCCTCGTCTTCATGG - Intronic
1020866643 7:13572456-13572478 ATGTATTTGCTTGGTTTTTAGGG + Intergenic
1021664447 7:22962054-22962076 CTGGCTTTATCTTGTTTTTATGG - Intronic
1021885699 7:25136556-25136578 CTTCAATATCCTGGTTTTTATGG + Exonic
1023231500 7:38035310-38035332 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1023450904 7:40283968-40283990 CAGGATTTTCTTCATTTTTAAGG - Intronic
1023537505 7:41229033-41229055 ATGGATTTCCATGGTTTTGAGGG + Intergenic
1023542756 7:41283610-41283632 CTGGATTTTGCTGCATTTTTAGG + Intergenic
1023657403 7:42438511-42438533 ATGTATTTGCCTGGTTTTGAGGG + Intergenic
1023681274 7:42690473-42690495 CTGGGTTTTACCTGTTTTTAGGG + Intergenic
1025061949 7:55817172-55817194 ATAGAATTTCCTGATTTTTAAGG - Intronic
1026161421 7:67872498-67872520 CCTAATTTTCCTGGTCTTTAAGG - Intergenic
1027176934 7:75910228-75910250 CTTGATTTTCTTTTTTTTTAAGG - Intronic
1027568514 7:79830461-79830483 CAGGATTTTCTTCTTTTTTATGG - Intergenic
1027818087 7:83004550-83004572 CAGGATTTTTATGGTTTTTATGG - Intronic
1028616577 7:92775257-92775279 CAAGATTTTCCTGGAATTTAAGG + Intronic
1029011372 7:97265216-97265238 TTGCATTTTCCTGCTTTTTAGGG - Intergenic
1029754264 7:102562494-102562516 CTGCATTTTATTGGTTTGTATGG + Intronic
1029772214 7:102661584-102661606 CTGCATTTTATTGGTTTGTATGG + Intronic
1029851827 7:103469559-103469581 CAGGATTTCCTTTGTTTTTAAGG + Intergenic
1030263702 7:107594081-107594103 CTGGATTTTCCCTATTTTTTTGG + Exonic
1030831250 7:114224814-114224836 CTGGCTATTCCTGATTTTAAAGG + Intronic
1031569171 7:123336716-123336738 CTGGATTTCATTGTTTTTTATGG - Intergenic
1031673245 7:124578066-124578088 CTGCATTTTCATGGTTTTATTGG + Intergenic
1031796951 7:126186556-126186578 ATGGATTCTCTTGGTTTTTGTGG + Intergenic
1032229290 7:130060275-130060297 ATGTATTTTTTTGGTTTTTATGG + Intergenic
1032288938 7:130568909-130568931 ATGTATTTGCCTGGTTTTCAAGG - Intronic
1033468938 7:141625860-141625882 CTGGCTTTTTCTCATTTTTAGGG + Intronic
1033614180 7:142996355-142996377 CAGGATTTTACTCTTTTTTATGG - Intergenic
1034159006 7:148978674-148978696 CTGGCTTTTCATGATTTTCATGG + Intergenic
1034445918 7:151114471-151114493 CTGGAATTTCCTGTTTTCGAGGG + Intronic
1034475421 7:151278824-151278846 CAGGATTTTCTTCCTTTTTAAGG + Intergenic
1035380363 7:158435740-158435762 CAGGATTTTCTTCTTTTTTAAGG - Intronic
1036423579 8:8621166-8621188 CTGGACTTTCCTGTTTTGGAAGG - Intergenic
1036520490 8:9487137-9487159 TTTGTTTTCCCTGGTTTTTAGGG - Intergenic
1036605151 8:10298288-10298310 CTGAATTTTCTTCCTTTTTAGGG - Intronic
1037942912 8:22967227-22967249 CTGAATTTTCTTCCTTTTTAAGG - Intronic
1038251513 8:25909403-25909425 CTGGATTTTTTTTTTTTTTAAGG - Intronic
1038469427 8:27800881-27800903 CTGGATTTGCCTGCCTCTTATGG - Intronic
1039133964 8:34298600-34298622 CTGGTTTTTCCTCATCTTTATGG - Intergenic
1039384628 8:37123417-37123439 CAGACTTTTCTTGGTTTTTATGG - Intergenic
1040566492 8:48572267-48572289 CTGGAATTTCCTTGTGTTTGAGG + Intergenic
1041658657 8:60379115-60379137 CTGGATTTACCTGTTTTATAGGG + Intergenic
1041766738 8:61426659-61426681 CTGGATTTGCCTGGTGTTTGAGG + Intronic
1041800074 8:61789148-61789170 CAGGATTTTCTTCCTTTTTATGG + Intergenic
1041932211 8:63299206-63299228 CTGGCTGGTCCTGGCTTTTAAGG + Intergenic
1042405957 8:68405889-68405911 CTGAATTTTTCTGGTGTTTTAGG + Intronic
1042530313 8:69808002-69808024 TCAGAATTTCCTGGTTTTTAAGG + Intronic
1043340109 8:79228195-79228217 CTTTATTTGCCTGCTTTTTAAGG + Intergenic
1044187471 8:89272044-89272066 GTGGATTTTCCTAGTTTTTTGGG + Intergenic
1044440532 8:92218695-92218717 CTGGATTTTTTTGGTTGGTAGGG + Intergenic
1044494006 8:92854844-92854866 CTGGATTTCCTTCTTTTTTAAGG - Intergenic
1044907476 8:97020075-97020097 ATGTATTTGCCTGGTTTTGAAGG - Intronic
1045270986 8:100661428-100661450 CTTGTTATTCCTGGTTTTGATGG - Intronic
1045386691 8:101678013-101678035 CTGAAATTTTCTGGTTTTTGAGG - Intergenic
1046290605 8:112154780-112154802 CAGGATTTTACTCCTTTTTAAGG + Intergenic
1046456454 8:114470579-114470601 CTGGATTGTCATTGTTTATAAGG + Intergenic
1047520578 8:125592626-125592648 CTTGATTTCTCTGGTTTCTAGGG + Intergenic
1047530879 8:125674154-125674176 ATGTATTTGCCTGGTTTTGAAGG + Intergenic
1048086240 8:131183661-131183683 AGGGATTTTCCTGGTTGATAGGG - Intergenic
1048954042 8:139519510-139519532 CAGGATTTTCTTCTTTTTTATGG + Intergenic
1049516638 8:143062359-143062381 GTGTATTTTCTTGGTTTTTCAGG - Intergenic
1050089588 9:2004081-2004103 CAGGATTTTCTTCCTTTTTAAGG - Intergenic
1050193540 9:3055935-3055957 CTTGTATTTCCTGGATTTTATGG - Intergenic
1050599364 9:7234991-7235013 CTGGAGATACCTGGTTTTTAAGG - Intergenic
1051864968 9:21669670-21669692 CAGGATTTTCTTCTTTTTTATGG + Intergenic
1051908250 9:22121719-22121741 CAGGATTTTATTGCTTTTTATGG + Intergenic
1052253792 9:26429547-26429569 ATGTATTTTCTTGGTTTTGAGGG - Intergenic
1052579541 9:30337426-30337448 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1052909421 9:33867046-33867068 CTAAATATTCCTGGTTTTTTTGG + Intronic
1054737904 9:68774263-68774285 CTGGAGTCTACTGGTGTTTAGGG + Intronic
1054853116 9:69869272-69869294 CAGGATTTTCTTCTTTTTTAAGG - Intronic
1055129358 9:72756658-72756680 CTGACTTTTTCTGTTTTTTAAGG + Intronic
1055477854 9:76681077-76681099 CTGGATTTTCTTCCTTTTTAAGG - Intronic
1057941578 9:99289653-99289675 CTGGACATTCCTGGTGTTTCGGG + Intergenic
1057979328 9:99643331-99643353 CAGGATTTTCTTCCTTTTTAAGG - Intergenic
1059032914 9:110719939-110719961 ATGTATTTTCATGGTTTTGAGGG - Intronic
1059532779 9:115052125-115052147 CAGAATTTTCCTCTTTTTTAAGG - Intronic
1059967484 9:119629598-119629620 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1060346261 9:122818640-122818662 TTTGATTTTCCTGGCTTTTCAGG - Exonic
1060560863 9:124541835-124541857 CAGGACTTTCCTCTTTTTTAAGG - Intronic
1061673754 9:132203848-132203870 CTGGAGCTTCCTGGGTTTTCTGG - Intronic
1062713849 9:137992881-137992903 CTGTATTTGCCTGGTTTTGTGGG - Intronic
1202797581 9_KI270719v1_random:138399-138421 ATGGATTTGTCTAGTTTTTAAGG - Intergenic
1185972765 X:4682840-4682862 CTGGAGTTTCCAGGTTTCCACGG - Intergenic
1186195208 X:7104218-7104240 TAGGATTTTCCTCCTTTTTAAGG - Intronic
1186570214 X:10707167-10707189 ATGGATGATCCTGGTTTTTCAGG + Intronic
1186830709 X:13387361-13387383 CTGGATTCTCCTGGTATTGGTGG - Intergenic
1187013353 X:15302297-15302319 TTGGATTTTCATGGTTTCTGTGG - Intronic
1187444945 X:19352806-19352828 CTGGACTTTTCTGGGTTTTCTGG - Intronic
1187695917 X:21920047-21920069 CCGTATTTGCATGGTTTTTAGGG + Intergenic
1188089816 X:25950807-25950829 CAGGATTTTATTGCTTTTTAGGG + Intergenic
1188676441 X:32946727-32946749 CTGGATTTTCTTTGAATTTACGG + Intronic
1188928408 X:36074957-36074979 CTGGATTTCACTCTTTTTTAAGG + Intronic
1189379609 X:40492821-40492843 GTGGATTTCCTTTGTTTTTAGGG - Intergenic
1190341335 X:49299118-49299140 CTGGATTTTCCTCATCTTTGTGG + Intronic
1190566636 X:51737070-51737092 CTGGATCTTCCTACTTATTAGGG + Intergenic
1191026459 X:55919351-55919373 CTGGATTTTCTTGGCTTTCCTGG - Intergenic
1191067463 X:56365718-56365740 ATGTATTTTCATGGTTTTGAAGG + Intergenic
1191725669 X:64278342-64278364 CTGGTTTTTCCTCATTTTTGTGG + Intronic
1191819986 X:65295253-65295275 ATGTATTTGCATGGTTTTTAAGG - Intergenic
1191824960 X:65354489-65354511 CTGGTTTTTCCTCATTTTCATGG - Intergenic
1191994309 X:67074640-67074662 ATGTATTTGCATGGTTTTTAAGG - Intergenic
1192164202 X:68815419-68815441 ATGTATTTTCATGGTTTTGAAGG - Intergenic
1192913411 X:75629667-75629689 ATGTATTTGCCTGGTTTTGAAGG + Intergenic
1193302787 X:79911643-79911665 CAGAATTTTGCTGCTTTTTAAGG + Intergenic
1193645824 X:84067154-84067176 CTGGTTTTTCCTCATTTTTGTGG - Intronic
1193739491 X:85201342-85201364 CTCTATTTTGCTGGCTTTTAAGG + Intergenic
1193924986 X:87473821-87473843 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1194124861 X:90004006-90004028 TTGTCTTTTCCTAGTTTTTAGGG + Intergenic
1194798271 X:98239947-98239969 CTGGTTTTTCCTCGTCTTCATGG + Intergenic
1194992367 X:100558308-100558330 TTGGATATTACTGTTTTTTAAGG - Intergenic
1195237350 X:102914038-102914060 ATGTATTTGCATGGTTTTTAAGG - Intergenic
1196129405 X:112138059-112138081 CAGGATTTTCTTCTTTTTTAAGG - Intergenic
1196273054 X:113735114-113735136 CTGGATTTTCCTCATCTTTGTGG + Intergenic
1196317576 X:114247102-114247124 CAGGATTTTCTTCTTTTTTAGGG - Intergenic
1197363804 X:125538852-125538874 ATGTATTTTCATGGTTTTGAAGG - Intergenic
1197651327 X:129068037-129068059 CAGGATTTCCTTGTTTTTTAAGG - Intergenic
1198395448 X:136214685-136214707 CTGCATTCTTGTGGTTTTTAGGG + Intronic
1198940209 X:141946225-141946247 CAGGATTTTCTTCTTTTTTAAGG + Intergenic
1198999341 X:142615753-142615775 CTGGGTTTTCTGGGTTTTTGAGG - Intergenic
1199477252 X:148259516-148259538 CTGGTTTTTCCTCATTTTTGTGG + Intergenic
1200477751 Y:3661615-3661637 TTGTCTTTTCCTAGTTTTTAAGG + Intergenic
1200934653 Y:8727759-8727781 CTGGATTTGCCTGGTAATCAAGG - Intergenic
1201350901 Y:13040158-13040180 ATGGATTTTTTTGGTTTATATGG - Intergenic
1201566777 Y:15373483-15373505 CTAGATCTTCTGGGTTTTTATGG - Intergenic
1201624444 Y:15998716-15998738 CTGGGTGTTCCTAGTTTTTGAGG - Intergenic
1202376214 Y:24240024-24240046 CTGGTTTTCCGTGGTTTTCATGG - Intergenic
1202494566 Y:25430094-25430116 CTGGTTTTCCGTGGTTTTCATGG + Intergenic