ID: 1168011638

View in Genome Browser
Species Human (GRCh38)
Location 19:53538090-53538112
Sequence GTGCGCGTGCGCATGCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168011638 Original CRISPR GTGCGCGTGCGCATGCGCGC TGG Intronic
900222827 1:1518481-1518503 GTGTGCGTGCCCATGTGTGCGGG - Intronic
900345365 1:2207958-2207980 GTGCGCGCGCGCATGCGTGCAGG + Intronic
902237349 1:15065891-15065913 GTGCGTGTGCACGTGTGCGCTGG + Intronic
903324695 1:22563329-22563351 GTGGGCGTGCGCACGTGCGGCGG + Intergenic
903389480 1:22953857-22953879 GTGCGCGCGCGCCTGGCCGCGGG - Exonic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
909622375 1:77683047-77683069 GTGCGCGCGCACGTGTGCGCGGG - Intronic
915818781 1:158999084-158999106 GTGTGCGCGCGCACGCACGCAGG - Intergenic
917906603 1:179591820-179591842 GCGCTGGTGCGCAGGCGCGCGGG + Exonic
919141402 1:193576467-193576489 GCGCGTGTGTGCATGCGTGCAGG + Intergenic
922501571 1:226100698-226100720 GTGGGTGGGCGCATGCGCACAGG + Intergenic
922648924 1:227319346-227319368 GTGTGTGTGCGCATGCACACAGG - Intergenic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
924524609 1:244835306-244835328 GTGCGTGTGAGCACGCGCGCCGG + Exonic
1063624142 10:7673671-7673693 GTGTGCATGCGCATGAGCCCAGG - Intergenic
1065483585 10:26216612-26216634 GTGCGTGTGTGTATGCGAGCTGG - Exonic
1065997592 10:31073699-31073721 GTGTGCGTGCGCATGTGTGTAGG + Intergenic
1069850686 10:71402751-71402773 GCGCGCGCGCACATGCGCGTTGG + Intronic
1069913597 10:71774032-71774054 GTGCGCGCGCGCATGCACTCAGG - Intronic
1071026402 10:81119557-81119579 GTGTGCGTGTGCATGCACACAGG - Intergenic
1071997569 10:91163012-91163034 GTGCGCGAGCGCGCGCGCGTGGG - Intronic
1072129450 10:92479635-92479657 GTGCGTGTGTGCGTGCGCACTGG + Intronic
1073062045 10:100738994-100739016 GTCCGCGTGCGCGCGCGCGACGG - Intronic
1073147958 10:101292629-101292651 GCGCGCGTGCGTGTGCGCGGCGG - Intergenic
1073543283 10:104329032-104329054 GTGTGTGTGTGCATGCGTGCAGG - Intronic
1074465707 10:113679658-113679680 GTGCGCGTTCTCCCGCGCGCGGG + Intronic
1076132068 10:128020072-128020094 GTGTGCGTGCACATGCACGCTGG + Intronic
1076650180 10:131982019-131982041 CTGCGCGTGCGCAGGGGCGTGGG + Intergenic
1076935478 10:133565787-133565809 GTGCCCCCGCGCATGTGCGCTGG + Intronic
1077124337 11:925813-925835 GCGTGCGTGCGCGTGCGTGCTGG + Intronic
1077190801 11:1255310-1255332 GTGCGTGCGTGCATGCGGGCGGG - Intronic
1078067291 11:8086773-8086795 GTGTGCTTGCACATGCCCGCTGG + Intronic
1080678678 11:34452543-34452565 GTGCGTGCGCGCATGCGGGAGGG + Intronic
1083742777 11:64719860-64719882 GTGCGCGTGTGTGTGCGTGCAGG + Intronic
1084630295 11:70343817-70343839 GTGCGCGTCGGCCTGCCCGCTGG - Exonic
1088780442 11:113128939-113128961 GTGTGTGTGTGCATGCGTGCAGG + Intronic
1090185921 11:124739253-124739275 GTGTGCGTGCGTGAGCGCGCGGG + Intergenic
1090671866 11:128953462-128953484 GTGCGCGTGTGCATGCACATGGG + Intergenic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092989452 12:13881018-13881040 GTGCGCGCACGCATGTGCGCAGG + Intronic
1095180863 12:39145230-39145252 GTGGGCGCGCGCTTTCGCGCCGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100613342 12:96210548-96210570 GTGTGCGTGCGCCCGCGCGCAGG - Intronic
1101640575 12:106583586-106583608 GTGTGCGTGCGCGCGCGCGAAGG + Intronic
1103907210 12:124333828-124333850 GTGCGGGTGCGCCTGTGTGCGGG + Intronic
1103907213 12:124333858-124333880 GTGTGTGTGCGCATGTGTGCGGG + Intronic
1103907215 12:124333892-124333914 GTGTGCGCGCGCATGTGTGCGGG + Intronic
1103907221 12:124333962-124333984 GTGCGGGTGCGCATGTGTGCGGG + Intronic
1105049641 12:133037271-133037293 GTGCATGTGCGCATGCGCGAAGG - Intronic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1115572373 14:34678884-34678906 GTGCATGTGTGCATGCGCGTGGG + Intergenic
1117434870 14:55706292-55706314 GTGTGTGTGCGCATGCACTCAGG + Intergenic
1118330456 14:64811348-64811370 GTGCGTGTGTGCATGCACGTGGG - Intronic
1120168060 14:81221033-81221055 AGCCGCGTGCGCAGGCGCGCCGG + Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122930736 14:104932064-104932086 GTGCGCGTGCGCCTGCTGGTCGG + Exonic
1127415133 15:58749923-58749945 AGGGGCGCGCGCATGCGCGCGGG + Exonic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129038657 15:72665912-72665934 GTGGGGGTGGGCATGGGCGCTGG + Intronic
1129728366 15:77915591-77915613 GTGGGGGTGGGCATGGGCGCTGG - Intergenic
1129905149 15:79182086-79182108 GTGCGTGTGTGCACGTGCGCTGG - Intergenic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1132831329 16:1929813-1929835 GTCTGCGTGCGCAGGCGCGGCGG - Intergenic
1133054471 16:3138653-3138675 GGGCGTGTGTGCATGCGCACAGG + Intronic
1134070688 16:11257688-11257710 GTGTGCGTGCGCGTGCGTGAGGG + Intronic
1138539852 16:57681374-57681396 GTGCGCGCGTGCGTGCGCGCAGG + Intronic
1142704226 17:1684402-1684424 GTGCGCGCGCGCAGGCGGGTGGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143155370 17:4833254-4833276 GCTCGCCTGCGCCTGCGCGCAGG + Intergenic
1145963865 17:28903095-28903117 GTGCGCGTGCGGGTGCGCGCCGG + Intergenic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147143077 17:38469922-38469944 GTGTGCGTGCGCAGGAGCGAGGG + Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1152461368 17:80444113-80444135 GGGGGCGTGCGCATGTGTGCGGG + Intergenic
1153646716 18:7202537-7202559 GTGTGTGTGTGCGTGCGCGCGGG - Intergenic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1155368547 18:25074076-25074098 GTGCGTGTGTGCACGCGCACGGG + Intronic
1160736137 19:663198-663220 GTGAGCGTGCGCGGGCGCGTCGG - Exonic
1160858950 19:1229563-1229585 GCGGGCGTGCGGGTGCGCGCGGG + Exonic
1160867170 19:1261076-1261098 GTGCGCAGGCGCAAGCGCGGAGG + Intronic
1161950974 19:7467767-7467789 GTTCGCGGGTGCATGCGTGCAGG + Intronic
1162784052 19:13023233-13023255 GTGCGCGTGTGTGTGCGCACTGG - Intronic
1163146069 19:15379974-15379996 GGCGGGGTGCGCATGCGCGCGGG - Intergenic
1165080220 19:33302497-33302519 GTGCGCGGGCGCGGGCGAGCAGG - Exonic
1165362759 19:35346785-35346807 GTGTGTGCGCACATGCGCGCAGG - Exonic
1166660451 19:44643823-44643845 CTGCGCAGGCGCAGGCGCGCGGG + Exonic
1167207174 19:48110502-48110524 GGGCGTGTGCGCATGCGCGGTGG + Exonic
1167517052 19:49929546-49929568 GCGCGGCTGCGCATGCGCACTGG + Intronic
1167740422 19:51321981-51322003 GTGCGTGTGCACATGTGTGCAGG + Intronic
1168011638 19:53538090-53538112 GTGCGCGTGCGCATGCGCGCTGG + Intronic
926285369 2:11483173-11483195 TTGTGCGTGCGTGTGCGCGCGGG + Intergenic
928490518 2:31778325-31778347 GTGCACGTGCACATGCATGCTGG - Intergenic
938199869 2:129363744-129363766 GTGCGTGTGTGCATGCGAGAGGG - Intergenic
942803959 2:179908119-179908141 GTGTGTGTGTGCATGTGCGCGGG + Intergenic
944242616 2:197500324-197500346 GGGCGAGCGCGCCTGCGCGCTGG + Exonic
944683637 2:202098818-202098840 GTGCACGCGCGCGCGCGCGCAGG + Intronic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
945319615 2:208406695-208406717 GAGCGCGAGCGCAGCCGCGCGGG + Intronic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
946219820 2:218217050-218217072 GAACGCGAGCGCAGGCGCGCCGG - Intergenic
947518830 2:230828748-230828770 GTGGGCGGGCGCCTGCGCTCAGG - Intergenic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
1170226312 20:13995359-13995381 CTGCGCCTGCGCGTGCGCCCTGG + Exonic
1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG + Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174467865 20:50731430-50731452 GTGCGCGCGCGCGGGCTCGCGGG + Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1177078339 21:16606911-16606933 GTGCGTGTGCGCATGTGCACAGG + Intergenic
1178021871 21:28417468-28417490 GTGCGCGCGCGCAGGTGTGCAGG + Intergenic
1179539165 21:42073042-42073064 GTGCGTGTGCGCATGTGTGCAGG + Intronic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1179813276 21:43885825-43885847 GTGCAGGTGCGCAGGTGCGCAGG + Intronic
1180172807 21:46068662-46068684 GTGCGTGTGCGCATGTGCCTGGG + Intergenic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1183034868 22:35134019-35134041 GTGTGTGTGCGCGTGTGCGCAGG + Intergenic
1184673348 22:46027347-46027369 GTGCGTGTGCGGGTGCGTGCGGG - Intergenic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
950534333 3:13570590-13570612 GTGCGCGGCCGCGTGCCCGCCGG + Exonic
950765419 3:15269660-15269682 GTGTGCGCGTGCATGCGCGCTGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954151836 3:48661802-48661824 GAGCGCATGCGCTTGGGCGCCGG + Exonic
961988053 3:131158351-131158373 GTGTGCATGCACATGCACGCTGG - Intronic
962808913 3:138945832-138945854 GTGTGCGTGCGGATGCGGGTGGG + Exonic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966982733 3:185153058-185153080 GTGCGCGTGCGTGTGCGCGTGGG - Intergenic
967171791 3:186827562-186827584 GTGCGCCTGCGCGAGCGCGGCGG + Intergenic
968556534 4:1248776-1248798 GTGCGAGTGCGCGTGCGCGCCGG - Intronic
970593188 4:17577179-17577201 GTGCGCCCGCGCATGCGGGCGGG - Exonic
970617442 4:17781352-17781374 GTGCACGTGCGTGCGCGCGCGGG + Exonic
973551301 4:52038322-52038344 GGGCGCAAGCGCAGGCGCGCAGG - Exonic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
974700860 4:65443939-65443961 GTGCACGCGCACATGCGCACTGG + Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
978443886 4:108762706-108762728 GGGCGCGTGCACAGGCGCGGCGG + Intronic
979469021 4:121072685-121072707 GTGTGTGTGTGCGTGCGCGCTGG - Intronic
980208162 4:129748940-129748962 GTGTGTGTGTGCATGCGTGCAGG + Intergenic
981061277 4:140427657-140427679 GTGCGCGTGCGGTGGCGGGCGGG + Exonic
982000301 4:151015746-151015768 GTGCGCGAGCGCGAGTGCGCGGG + Intergenic
982257765 4:153466781-153466803 GTGCGCGGGCCCCTGCGCCCCGG + Intronic
983076360 4:163331909-163331931 GTGGGGGTGGGCTTGCGCGCTGG + Intronic
985988392 5:3536102-3536124 GCGCGGGTGAGCGTGCGCGCGGG - Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
988722235 5:33890683-33890705 GTGTGCGTGTGCATGCGTGTGGG + Intronic
989137213 5:38167306-38167328 GTGCGTGTGCACATGTGTGCGGG + Intergenic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1009952500 6:70413490-70413512 GGGCGACTGCGCATGCTCGCTGG + Exonic
1011281135 6:85678931-85678953 GTGCGCCTGCGGGCGCGCGCCGG - Intergenic
1014811123 6:125886898-125886920 GTGCGCGTGCACACACGTGCAGG + Intronic
1015403711 6:132814502-132814524 GTGGGAGTGCACATGCGCACAGG + Exonic
1018329956 6:162716755-162716777 GTGTGCGTGCGCGCGCGCGCAGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1021669065 7:23016488-23016510 GTGTGTGTGTGCATGCGCGTAGG - Intergenic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1023638607 7:42237200-42237222 GTGCGAGTGTGCGAGCGCGCCGG + Intronic
1024088283 7:45915115-45915137 GTGCGCCTGTGCATGCGTGTGGG + Intronic
1026522744 7:71131497-71131519 GTGCGCGCGCGCACCCGGGCAGG - Intergenic
1030083380 7:105797113-105797135 GTGAGCGTGCGGGTGCGTGCAGG + Intronic
1031150842 7:118052438-118052460 GTACGCTTGTGCATGCGTGCAGG - Intergenic
1032733052 7:134663394-134663416 GTGCACGTGCGCATGTGCGTGGG + Intronic
1033415425 7:141157416-141157438 GTGTGTGTGTGCACGCGCGCAGG - Intronic
1034698320 7:153074680-153074702 GTGCACGTGTGCAAGCACGCAGG + Intergenic
1036391603 8:8328763-8328785 GTGTGTGTGCGCACGCGTGCAGG - Intronic
1037806481 8:22060434-22060456 GTGTGCGTGCGCATGTGTGAGGG - Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039379325 8:37070184-37070206 GTGTGCGTGCACATGCTAGCAGG + Intergenic
1043348771 8:79333365-79333387 GTGTGTGTGTGCATGCGCACGGG + Intergenic
1044661813 8:94598873-94598895 GTGTGTGTGCGCGTGCGCGCGGG + Intergenic
1053137120 9:35658292-35658314 GCTCGCGTGCGCGTGCGCGTTGG + Exonic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1061239515 9:129361237-129361259 GTGTGCGTGAGTATGCGCGTGGG + Intergenic
1061453490 9:130681578-130681600 GGGCGCGTGCGCGTGCGGGGCGG - Exonic
1187487990 X:19722548-19722570 GTGTGTGTGCGCGTGCGCACTGG + Intronic
1187533540 X:20116933-20116955 GTGCGCATGCGGACGCGCGCGGG - Intergenic
1192216742 X:69164630-69164652 GTGTGCCTGCGCATGCGCGGGGG + Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1197093938 X:122571868-122571890 GTGCACCTGCGCATGCACACTGG - Intergenic
1199270086 X:145872913-145872935 GTGCACATGCGCATGCGTGCTGG + Intergenic
1200136842 X:153879433-153879455 GTGCACGTGCGCGTGCGCGCAGG + Intronic
1200155532 X:153972739-153972761 GCGCCGGTGCGCCTGCGCGCAGG - Exonic