ID: 1168011638

View in Genome Browser
Species Human (GRCh38)
Location 19:53538090-53538112
Sequence GTGCGCGTGCGCATGCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168011638 Original CRISPR GTGCGCGTGCGCATGCGCGC TGG Intronic