ID: 1168025041

View in Genome Browser
Species Human (GRCh38)
Location 19:53637770-53637792
Sequence TGGACCTGACCTATATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168025041_1168025046 19 Left 1168025041 19:53637770-53637792 CCTGGGCATATAGGTCAGGTCCA No data
Right 1168025046 19:53637812-53637834 GCGAACCCTTCCTCAAGGCCTGG No data
1168025041_1168025050 26 Left 1168025041 19:53637770-53637792 CCTGGGCATATAGGTCAGGTCCA No data
Right 1168025050 19:53637819-53637841 CTTCCTCAAGGCCTGGAGGTTGG No data
1168025041_1168025047 22 Left 1168025041 19:53637770-53637792 CCTGGGCATATAGGTCAGGTCCA No data
Right 1168025047 19:53637815-53637837 AACCCTTCCTCAAGGCCTGGAGG No data
1168025041_1168025045 14 Left 1168025041 19:53637770-53637792 CCTGGGCATATAGGTCAGGTCCA No data
Right 1168025045 19:53637807-53637829 TCAATGCGAACCCTTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168025041 Original CRISPR TGGACCTGACCTATATGCCC AGG (reversed) Intergenic
No off target data available for this crispr