ID: 1168026515

View in Genome Browser
Species Human (GRCh38)
Location 19:53647671-53647693
Sequence GTCTCCATTGCCCCCCAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168026509_1168026515 -1 Left 1168026509 19:53647649-53647671 CCGTGACCCTGTCCCTCTTCTTG No data
Right 1168026515 19:53647671-53647693 GTCTCCATTGCCCCCCAAGCGGG No data
1168026508_1168026515 0 Left 1168026508 19:53647648-53647670 CCCGTGACCCTGTCCCTCTTCTT No data
Right 1168026515 19:53647671-53647693 GTCTCCATTGCCCCCCAAGCGGG No data
1168026506_1168026515 7 Left 1168026506 19:53647641-53647663 CCCTACGCCCGTGACCCTGTCCC No data
Right 1168026515 19:53647671-53647693 GTCTCCATTGCCCCCCAAGCGGG No data
1168026510_1168026515 -7 Left 1168026510 19:53647655-53647677 CCCTGTCCCTCTTCTTGTCTCCA No data
Right 1168026515 19:53647671-53647693 GTCTCCATTGCCCCCCAAGCGGG No data
1168026507_1168026515 6 Left 1168026507 19:53647642-53647664 CCTACGCCCGTGACCCTGTCCCT No data
Right 1168026515 19:53647671-53647693 GTCTCCATTGCCCCCCAAGCGGG No data
1168026504_1168026515 14 Left 1168026504 19:53647634-53647656 CCTCTGCCCCTACGCCCGTGACC No data
Right 1168026515 19:53647671-53647693 GTCTCCATTGCCCCCCAAGCGGG No data
1168026511_1168026515 -8 Left 1168026511 19:53647656-53647678 CCTGTCCCTCTTCTTGTCTCCAT No data
Right 1168026515 19:53647671-53647693 GTCTCCATTGCCCCCCAAGCGGG No data
1168026505_1168026515 8 Left 1168026505 19:53647640-53647662 CCCCTACGCCCGTGACCCTGTCC No data
Right 1168026515 19:53647671-53647693 GTCTCCATTGCCCCCCAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168026515 Original CRISPR GTCTCCATTGCCCCCCAAGC GGG Intergenic
No off target data available for this crispr