ID: 1168027465

View in Genome Browser
Species Human (GRCh38)
Location 19:53653099-53653121
Sequence CAGGGCCACATGGTATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168027465_1168027476 24 Left 1168027465 19:53653099-53653121 CCTCCTAATACCATGTGGCCCTG No data
Right 1168027476 19:53653146-53653168 CAGGTTCAGGGTTCCATTCCCGG No data
1168027465_1168027470 -4 Left 1168027465 19:53653099-53653121 CCTCCTAATACCATGTGGCCCTG No data
Right 1168027470 19:53653118-53653140 CCTGCTTTCTCTTTTCACAACGG No data
1168027465_1168027473 11 Left 1168027465 19:53653099-53653121 CCTCCTAATACCATGTGGCCCTG No data
Right 1168027473 19:53653133-53653155 CACAACGGCAGGCCAGGTTCAGG No data
1168027465_1168027471 0 Left 1168027465 19:53653099-53653121 CCTCCTAATACCATGTGGCCCTG No data
Right 1168027471 19:53653122-53653144 CTTTCTCTTTTCACAACGGCAGG No data
1168027465_1168027472 5 Left 1168027465 19:53653099-53653121 CCTCCTAATACCATGTGGCCCTG No data
Right 1168027472 19:53653127-53653149 TCTTTTCACAACGGCAGGCCAGG No data
1168027465_1168027474 12 Left 1168027465 19:53653099-53653121 CCTCCTAATACCATGTGGCCCTG No data
Right 1168027474 19:53653134-53653156 ACAACGGCAGGCCAGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168027465 Original CRISPR CAGGGCCACATGGTATTAGG AGG (reversed) Intergenic
No off target data available for this crispr