ID: 1168031809

View in Genome Browser
Species Human (GRCh38)
Location 19:53686049-53686071
Sequence GAAACACACAGGTACAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168031809_1168031814 17 Left 1168031809 19:53686049-53686071 CCTCACCTGTACCTGTGTGTTTC No data
Right 1168031814 19:53686089-53686111 AGCTTTTACAGCCTGGCCTGTGG No data
1168031809_1168031817 30 Left 1168031809 19:53686049-53686071 CCTCACCTGTACCTGTGTGTTTC No data
Right 1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG No data
1168031809_1168031815 27 Left 1168031809 19:53686049-53686071 CCTCACCTGTACCTGTGTGTTTC No data
Right 1168031815 19:53686099-53686121 GCCTGGCCTGTGGTCTCTCCTGG No data
1168031809_1168031813 10 Left 1168031809 19:53686049-53686071 CCTCACCTGTACCTGTGTGTTTC No data
Right 1168031813 19:53686082-53686104 ATTGAGGAGCTTTTACAGCCTGG No data
1168031809_1168031812 -6 Left 1168031809 19:53686049-53686071 CCTCACCTGTACCTGTGTGTTTC No data
Right 1168031812 19:53686066-53686088 TGTTTCTGCTCATTTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168031809 Original CRISPR GAAACACACAGGTACAGGTG AGG (reversed) Intergenic
No off target data available for this crispr