ID: 1168031810

View in Genome Browser
Species Human (GRCh38)
Location 19:53686054-53686076
Sequence GAGCAGAAACACACAGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168031810_1168031814 12 Left 1168031810 19:53686054-53686076 CCTGTACCTGTGTGTTTCTGCTC No data
Right 1168031814 19:53686089-53686111 AGCTTTTACAGCCTGGCCTGTGG No data
1168031810_1168031817 25 Left 1168031810 19:53686054-53686076 CCTGTACCTGTGTGTTTCTGCTC No data
Right 1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG No data
1168031810_1168031815 22 Left 1168031810 19:53686054-53686076 CCTGTACCTGTGTGTTTCTGCTC No data
Right 1168031815 19:53686099-53686121 GCCTGGCCTGTGGTCTCTCCTGG No data
1168031810_1168031813 5 Left 1168031810 19:53686054-53686076 CCTGTACCTGTGTGTTTCTGCTC No data
Right 1168031813 19:53686082-53686104 ATTGAGGAGCTTTTACAGCCTGG No data
1168031810_1168031818 26 Left 1168031810 19:53686054-53686076 CCTGTACCTGTGTGTTTCTGCTC No data
Right 1168031818 19:53686103-53686125 GGCCTGTGGTCTCTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168031810 Original CRISPR GAGCAGAAACACACAGGTAC AGG (reversed) Intergenic
No off target data available for this crispr