ID: 1168031811

View in Genome Browser
Species Human (GRCh38)
Location 19:53686060-53686082
Sequence TAAAATGAGCAGAAACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168031811_1168031818 20 Left 1168031811 19:53686060-53686082 CCTGTGTGTTTCTGCTCATTTTA No data
Right 1168031818 19:53686103-53686125 GGCCTGTGGTCTCTCCTGGAGGG No data
1168031811_1168031814 6 Left 1168031811 19:53686060-53686082 CCTGTGTGTTTCTGCTCATTTTA No data
Right 1168031814 19:53686089-53686111 AGCTTTTACAGCCTGGCCTGTGG No data
1168031811_1168031813 -1 Left 1168031811 19:53686060-53686082 CCTGTGTGTTTCTGCTCATTTTA No data
Right 1168031813 19:53686082-53686104 ATTGAGGAGCTTTTACAGCCTGG No data
1168031811_1168031817 19 Left 1168031811 19:53686060-53686082 CCTGTGTGTTTCTGCTCATTTTA No data
Right 1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG No data
1168031811_1168031815 16 Left 1168031811 19:53686060-53686082 CCTGTGTGTTTCTGCTCATTTTA No data
Right 1168031815 19:53686099-53686121 GCCTGGCCTGTGGTCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168031811 Original CRISPR TAAAATGAGCAGAAACACAC AGG (reversed) Intergenic
No off target data available for this crispr