ID: 1168031817

View in Genome Browser
Species Human (GRCh38)
Location 19:53686102-53686124
Sequence TGGCCTGTGGTCTCTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168031809_1168031817 30 Left 1168031809 19:53686049-53686071 CCTCACCTGTACCTGTGTGTTTC No data
Right 1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG No data
1168031811_1168031817 19 Left 1168031811 19:53686060-53686082 CCTGTGTGTTTCTGCTCATTTTA No data
Right 1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG No data
1168031810_1168031817 25 Left 1168031810 19:53686054-53686076 CCTGTACCTGTGTGTTTCTGCTC No data
Right 1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168031817 Original CRISPR TGGCCTGTGGTCTCTCCTGG AGG Intergenic
No off target data available for this crispr