ID: 1168034854

View in Genome Browser
Species Human (GRCh38)
Location 19:53711240-53711262
Sequence TGAATCCAAAAGACCTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168034854_1168034858 17 Left 1168034854 19:53711240-53711262 CCAACCTAGGTCTTTTGGATTCA No data
Right 1168034858 19:53711280-53711302 ACAGAGTCTCTCTATCACCCAGG 0: 2
1: 84
2: 803
3: 2849
4: 10773
1168034854_1168034857 -6 Left 1168034854 19:53711240-53711262 CCAACCTAGGTCTTTTGGATTCA No data
Right 1168034857 19:53711257-53711279 GATTCAAATGGTTTTTTTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168034854 Original CRISPR TGAATCCAAAAGACCTAGGT TGG (reversed) Intergenic
No off target data available for this crispr