ID: 1168040425

View in Genome Browser
Species Human (GRCh38)
Location 19:53754251-53754273
Sequence TGAATCCAAGAGACCTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168040425_1168040434 17 Left 1168040425 19:53754251-53754273 CCCACCTAGGTCTCTTGGATTCA No data
Right 1168040434 19:53754291-53754313 GCAGAGTCTCTCTATCACCGAGG No data
1168040425_1168040430 -7 Left 1168040425 19:53754251-53754273 CCCACCTAGGTCTCTTGGATTCA No data
Right 1168040430 19:53754267-53754289 GGATTCAAATGGTCCTTTTTGGG No data
1168040425_1168040432 -5 Left 1168040425 19:53754251-53754273 CCCACCTAGGTCTCTTGGATTCA No data
Right 1168040432 19:53754269-53754291 ATTCAAATGGTCCTTTTTGGGGG No data
1168040425_1168040435 21 Left 1168040425 19:53754251-53754273 CCCACCTAGGTCTCTTGGATTCA No data
Right 1168040435 19:53754295-53754317 AGTCTCTCTATCACCGAGGCTGG No data
1168040425_1168040429 -8 Left 1168040425 19:53754251-53754273 CCCACCTAGGTCTCTTGGATTCA No data
Right 1168040429 19:53754266-53754288 TGGATTCAAATGGTCCTTTTTGG No data
1168040425_1168040431 -6 Left 1168040425 19:53754251-53754273 CCCACCTAGGTCTCTTGGATTCA No data
Right 1168040431 19:53754268-53754290 GATTCAAATGGTCCTTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168040425 Original CRISPR TGAATCCAAGAGACCTAGGT GGG (reversed) Intergenic
No off target data available for this crispr