ID: 1168043744

View in Genome Browser
Species Human (GRCh38)
Location 19:53779250-53779272
Sequence AGGCTCCTGCCACTACGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168043742_1168043744 -4 Left 1168043742 19:53779231-53779253 CCCAAGTAGCTGGGATTACAGGC 0: 35616
1: 158937
2: 257753
3: 440394
4: 391946
Right 1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG No data
1168043743_1168043744 -5 Left 1168043743 19:53779232-53779254 CCAAGTAGCTGGGATTACAGGCT 0: 1770
1: 77189
2: 173996
3: 160263
4: 335839
Right 1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG No data
1168043740_1168043744 -1 Left 1168043740 19:53779228-53779250 CCTCCCAAGTAGCTGGGATTACA 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
Right 1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG No data
1168043738_1168043744 5 Left 1168043738 19:53779222-53779244 CCTCAGCCTCCCAAGTAGCTGGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655
Right 1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG No data
1168043735_1168043744 28 Left 1168043735 19:53779199-53779221 CCTGGGTTCAAGCGATTCTCCTG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
Right 1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG No data
1168043736_1168043744 9 Left 1168043736 19:53779218-53779240 CCTGCCTCAGCCTCCCAAGTAGC 0: 74529
1: 175606
2: 216051
3: 220891
4: 278507
Right 1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168043744 Original CRISPR AGGCTCCTGCCACTACGTCC AGG Intergenic
No off target data available for this crispr