ID: 1168049695

View in Genome Browser
Species Human (GRCh38)
Location 19:53819990-53820012
Sequence GTGTGCCAGTAGTAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168049695 Original CRISPR GTGTGCCAGTAGTAGTGTGC TGG (reversed) Intronic
900215465 1:1479261-1479283 GTGTGCCTGTACACGTGTGCTGG - Intronic
900222726 1:1517928-1517950 GTGTGCCTGTACACGTGTGCTGG - Intronic
902862177 1:19254283-19254305 GTGTGCCTGTAGTCCTGTGTGGG + Intronic
907752502 1:57276154-57276176 GTGTGCACACAGTAGTGTGCAGG + Intronic
911234074 1:95391168-95391190 GTAGGGCAGTAGCAGTGTGCAGG + Intergenic
913360290 1:117973029-117973051 TTTAGCCAGTAGTAGTATGCTGG + Intronic
918537415 1:185588927-185588949 GTGTCCCATTATTATTGTGCGGG - Intergenic
921097419 1:211899251-211899273 GTGGGCCAGAAGTAGTGAGGAGG - Intergenic
1067031388 10:42880375-42880397 GTGTGCGAGTGGGAGTGTCCAGG + Intergenic
1068217871 10:54006887-54006909 GTTTGCCTGTCTTAGTGTGCAGG - Intronic
1068945327 10:62723777-62723799 GTGGCCCAGTAGAAGTGTGGTGG + Intergenic
1074307725 10:112294416-112294438 GTGTGCAAGAGGAAGTGTGCAGG + Intronic
1080030731 11:27658123-27658145 GTGTGACAGTATTAGTGAGTGGG - Exonic
1087324787 11:96708379-96708401 GTGGGCAAGGAGGAGTGTGCAGG + Intergenic
1092770598 12:11892958-11892980 CTGTGACAGTAGGAGTGGGCTGG - Exonic
1093494791 12:19743823-19743845 GTGTGACAGTTGTATTGTGGGGG - Intergenic
1093886273 12:24465069-24465091 ATGTGCCAGTAATTGTGTGAAGG + Intergenic
1107427529 13:40308775-40308797 GTGGGGCAGTGGTAGTGTGGGGG - Intergenic
1110365754 13:74683550-74683572 GTGTGCCATGAGTAGGTTGCAGG + Intergenic
1113031098 13:105994527-105994549 GATTGCAAGTAGTAATGTGCAGG + Intergenic
1116040965 14:39686123-39686145 GTGTGCCAGTTTTACAGTGCTGG - Intergenic
1119717085 14:76867036-76867058 GTGTGCATGTGGTAGTGTGTGGG + Intronic
1122340198 14:101023009-101023031 GTGTGCCAGGCGCACTGTGCTGG - Intergenic
1123123714 14:105929890-105929912 GTGTGTCAGTGGCTGTGTGCAGG + Intronic
1126795672 15:52258908-52258930 ATGTGCAAGGAGTAGTGAGCTGG - Intronic
1126883092 15:53120195-53120217 CTGTGCCACTAGAAGTGTGTAGG - Intergenic
1132699689 16:1217021-1217043 GTGTGCCAGGAGGAGGGCGCAGG - Intronic
1134761153 16:16716395-16716417 GTGTCCCAGTAAGAGTGTGTTGG - Intergenic
1134984906 16:18642781-18642803 GTGTCCCAGTAAGAGTGTGTTGG + Intergenic
1139069393 16:63361690-63361712 ATGTGCCAGTAGTGGTATGTTGG + Intergenic
1139420448 16:66846284-66846306 GTGTGTCAGATGTAGTCTGCAGG + Intronic
1139528606 16:67530651-67530673 GTGTGCCAGTCTTGGTGTGTAGG + Intronic
1148534882 17:48430535-48430557 GGGTGCCTGAAGTAGGGTGCAGG + Intergenic
1148731867 17:49841724-49841746 CTGTGGCAGTAGGAATGTGCTGG + Intronic
1151362550 17:73597235-73597257 TTGTGTCAGTAGTGGGGTGCTGG - Intronic
1156432612 18:37092145-37092167 GTGTGCCAGCAGCAGTGGGCTGG - Intronic
1156691501 18:39712601-39712623 GTGTGCCAGAAGTAGGGTAAGGG + Intergenic
1159217263 18:65409476-65409498 GTGTGCCAGTTGTAGAATGCCGG - Intergenic
1159795540 18:72838531-72838553 GGATGACAGTAGAAGTGTGCAGG - Intronic
1160984024 19:1829138-1829160 GTGTGCCAGCGGTGGTGTGGTGG + Intronic
1161568902 19:5019236-5019258 GTGTGCACGTATTGGTGTGCAGG + Intronic
1161568949 19:5019520-5019542 GTGTGCACGTATTGGTGTGCAGG + Intronic
1161569009 19:5019884-5019906 GTGTGCAGGTGTTAGTGTGCAGG + Intronic
1161569017 19:5019936-5019958 GTGTGCAGGTGTTAGTGTGCAGG + Intronic
1161569018 19:5019950-5019972 GTGTGCAGGTGTTAGTGTGCAGG + Intronic
1161569039 19:5020091-5020113 GTGTGCAGGTGTTAGTGTGCAGG + Intronic
1161569040 19:5020105-5020127 GTGTGCAGGTGTTAGTGTGCAGG + Intronic
1161569056 19:5020209-5020231 GTGTGCAGGTGTTAGTGTGCAGG + Intronic
1163799499 19:19356074-19356096 GTCGGCCAGGAGTAGGGTGCAGG + Exonic
1165744862 19:38224510-38224532 GTGTGTGAGTAGGAGTGTGTGGG - Intronic
1168049695 19:53819990-53820012 GTGTGCCAGTAGTAGTGTGCTGG - Intronic
925444256 2:3914353-3914375 GTGTGCCAGGCACAGTGTGCAGG + Intergenic
927697947 2:25250804-25250826 GTGTGCAGGTAGCAGTGGGCGGG + Intronic
931040879 2:58298267-58298289 GCTTGCCAATAGTAATGTGCTGG + Intergenic
938145941 2:128835060-128835082 GGGTCCCAGTAGCAGTGGGCAGG - Intergenic
938479155 2:131645544-131645566 GTGTCCCTGTGGTAGTGTGACGG - Intergenic
938941357 2:136172252-136172274 GGGAGACAGAAGTAGTGTGCAGG + Intergenic
948097138 2:235344282-235344304 GTGTGCCTGTGTGAGTGTGCAGG - Intergenic
1168958752 20:1853678-1853700 GTGAGCCAGTAGGTGTCTGCAGG - Intergenic
1172950946 20:38723268-38723290 GTGTGCCAGAGCTAGTGTGTTGG - Intergenic
1173521706 20:43704838-43704860 ATGTGACAGTTGTAGTGTGCTGG - Intronic
1179298321 21:40082906-40082928 GAGTGACATCAGTAGTGTGCTGG - Intronic
1181728192 22:24826001-24826023 GTGTGCCACAAGCACTGTGCTGG + Intronic
954683762 3:52359621-52359643 GGGTGCCTGTGGTACTGTGCAGG - Intronic
956277568 3:67519405-67519427 GTGTAACATTAGAAGTGTGCTGG + Intronic
956945619 3:74218949-74218971 GTGTGCTGGTAGGAGTGTGTAGG + Intergenic
958662315 3:97087056-97087078 GTCTGGCAGGAGTAGTGTCCAGG - Intronic
959045078 3:101464996-101465018 GGGTGCCAGTAGTGGTGGGTGGG - Intronic
960369641 3:116817912-116817934 GGGTTACAGTAGTGGTGTGCTGG + Intronic
962256075 3:133871142-133871164 GTGTGCCAGTCCTGTTGTGCAGG + Intronic
967799706 3:193642632-193642654 GTGCCCCAGCAGTAGTGTGAAGG + Intronic
967933375 3:194706941-194706963 GTGTGTCAGCAGACGTGTGCTGG - Intergenic
970290004 4:14561641-14561663 GAATGCCAGCATTAGTGTGCAGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973926544 4:55744229-55744251 GTGGCCCAGTAGTGGTGGGCTGG + Intergenic
977519898 4:98068635-98068657 GTGTTCCAGAAGTTGTGTGTAGG + Intronic
978713479 4:111813746-111813768 GTGTAACAGTGGTAGTGTGTGGG - Intergenic
981718339 4:147774400-147774422 GTTTGCCTGTAAGAGTGTGCAGG + Intronic
986190298 5:5490915-5490937 GAGTGCCAGAAGGAGTCTGCTGG + Intergenic
993047248 5:82881312-82881334 CTGTGCCAGTGGCAGTGAGCAGG + Intergenic
996529055 5:124508585-124508607 GTGTGCCAGAATTAGTGAGGTGG + Intergenic
997258203 5:132445386-132445408 GTGTGGTAGTAGCAGTGTGGAGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997766518 5:136509904-136509926 GTGTGCCAGTAGCAGGGTGGTGG + Intergenic
999905872 5:156141031-156141053 GTGGTCAAGTAGCAGTGTGCTGG - Intronic
1000237673 5:159377375-159377397 CTGTGTCTGCAGTAGTGTGCCGG - Intergenic
1000524690 5:162342372-162342394 GTGTGCCAGGGGTGGTGTGCAGG - Intergenic
1002676201 5:180915156-180915178 GTGGGCCTCTAGTAGAGTGCAGG - Intronic
1004135306 6:12960559-12960581 GTGACCCAGTGGTAGAGTGCAGG - Intronic
1008601831 6:53103946-53103968 CTAAGCCAGTAGAAGTGTGCTGG - Intergenic
1014394713 6:120912064-120912086 GTGTGCCAGTAGTGGTGTTTTGG + Intergenic
1021471138 7:21003382-21003404 GGGTGCCAGTAACAGTGTGCTGG - Intergenic
1025784267 7:64630182-64630204 CTGTGCCTGTATTAGTTTGCTGG - Intergenic
1028836991 7:95385453-95385475 GTCTCCCAGTAGTATTGTGTGGG - Intronic
1036212149 8:6851127-6851149 GTGTGCATGTAGGTGTGTGCAGG - Intergenic
1036212189 8:6851513-6851535 GTGTGCATGTAGGTGTGTGCAGG - Intergenic
1037992760 8:23332434-23332456 GTGTGTCTGTAGGAGTGTGTGGG - Intronic
1040465609 8:47692253-47692275 ATGTGCCAGAATTAGGGTGCTGG - Intronic
1042000220 8:64114067-64114089 GTGTCCCAGCAGTGTTGTGCAGG + Intergenic
1044447657 8:92297319-92297341 GTGTGGCCTTAGTGGTGTGCAGG + Intergenic
1045324723 8:101109622-101109644 GAGAGCCAGTAGTACTGTGAGGG - Intergenic
1050957834 9:11687315-11687337 GTGTGGCAGCTGTGGTGTGCTGG + Intergenic
1052098290 9:24410972-24410994 GTCTCCCAGTAGTACTGTGTGGG - Intergenic
1054762489 9:69015463-69015485 GTTGGCTAGTAGTAGTGTTCAGG + Intergenic
1057901556 9:98953060-98953082 GTGTACCAGTGGTAGTGGGTAGG + Intronic
1059288465 9:113199003-113199025 CTATTCCAGAAGTAGTGTGCTGG - Intronic
1188263186 X:28041098-28041120 GGGTCCCAGTACTAGAGTGCTGG + Intergenic
1188768542 X:34126021-34126043 GAGTTCCAGTACCAGTGTGCTGG + Intergenic
1188835375 X:34948262-34948284 GTATACCAGTACCAGTGTGCTGG - Intergenic
1196816564 X:119669719-119669741 GGCTGCCAGCAGTGGTGTGCTGG - Intronic