ID: 1168052138

View in Genome Browser
Species Human (GRCh38)
Location 19:53837278-53837300
Sequence ACATGGCTGTTTATTTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168052138_1168052143 15 Left 1168052138 19:53837278-53837300 CCATGTGAAATAAACAGCCATGT No data
Right 1168052143 19:53837316-53837338 TGTTTGGTGGTCTCTTCACACGG 0: 1480
1: 638
2: 165
3: 77
4: 177
1168052138_1168052144 30 Left 1168052138 19:53837278-53837300 CCATGTGAAATAAACAGCCATGT No data
Right 1168052144 19:53837331-53837353 TCACACGGACGCGCATGAAATGG No data
1168052138_1168052140 -1 Left 1168052138 19:53837278-53837300 CCATGTGAAATAAACAGCCATGT No data
Right 1168052140 19:53837300-53837322 TTGCTCATACAAAGCCTGTTTGG 0: 24
1: 1864
2: 722
3: 158
4: 166
1168052138_1168052141 2 Left 1168052138 19:53837278-53837300 CCATGTGAAATAAACAGCCATGT No data
Right 1168052141 19:53837303-53837325 CTCATACAAAGCCTGTTTGGTGG 0: 24
1: 1838
2: 730
3: 166
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168052138 Original CRISPR ACATGGCTGTTTATTTCACA TGG (reversed) Intergenic
No off target data available for this crispr