ID: 1168052139

View in Genome Browser
Species Human (GRCh38)
Location 19:53837295-53837317
Sequence CAGGCTTTGTATGAGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168052139_1168052145 14 Left 1168052139 19:53837295-53837317 CCATGTTGCTCATACAAAGCCTG No data
Right 1168052145 19:53837332-53837354 CACACGGACGCGCATGAAATGGG No data
1168052139_1168052146 22 Left 1168052139 19:53837295-53837317 CCATGTTGCTCATACAAAGCCTG No data
Right 1168052146 19:53837340-53837362 CGCGCATGAAATGGGCTACATGG No data
1168052139_1168052143 -2 Left 1168052139 19:53837295-53837317 CCATGTTGCTCATACAAAGCCTG No data
Right 1168052143 19:53837316-53837338 TGTTTGGTGGTCTCTTCACACGG 0: 1480
1: 638
2: 165
3: 77
4: 177
1168052139_1168052144 13 Left 1168052139 19:53837295-53837317 CCATGTTGCTCATACAAAGCCTG No data
Right 1168052144 19:53837331-53837353 TCACACGGACGCGCATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168052139 Original CRISPR CAGGCTTTGTATGAGCAACA TGG (reversed) Intergenic
No off target data available for this crispr