ID: 1168052142

View in Genome Browser
Species Human (GRCh38)
Location 19:53837314-53837336
Sequence GTGTGAAGAGACCACCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2941
Summary {0: 1170, 1: 1149, 2: 398, 3: 94, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168052142_1168052146 3 Left 1168052142 19:53837314-53837336 CCTGTTTGGTGGTCTCTTCACAC 0: 1170
1: 1149
2: 398
3: 94
4: 130
Right 1168052146 19:53837340-53837362 CGCGCATGAAATGGGCTACATGG No data
1168052142_1168052145 -5 Left 1168052142 19:53837314-53837336 CCTGTTTGGTGGTCTCTTCACAC 0: 1170
1: 1149
2: 398
3: 94
4: 130
Right 1168052145 19:53837332-53837354 CACACGGACGCGCATGAAATGGG No data
1168052142_1168052144 -6 Left 1168052142 19:53837314-53837336 CCTGTTTGGTGGTCTCTTCACAC 0: 1170
1: 1149
2: 398
3: 94
4: 130
Right 1168052144 19:53837331-53837353 TCACACGGACGCGCATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168052142 Original CRISPR GTGTGAAGAGACCACCAAAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr