ID: 1168052143

View in Genome Browser
Species Human (GRCh38)
Location 19:53837316-53837338
Sequence TGTTTGGTGGTCTCTTCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2537
Summary {0: 1480, 1: 638, 2: 165, 3: 77, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168052135_1168052143 25 Left 1168052135 19:53837268-53837290 CCGCCTGCACCCATGTGAAATAA No data
Right 1168052143 19:53837316-53837338 TGTTTGGTGGTCTCTTCACACGG 0: 1480
1: 638
2: 165
3: 77
4: 177
1168052134_1168052143 26 Left 1168052134 19:53837267-53837289 CCCGCCTGCACCCATGTGAAATA No data
Right 1168052143 19:53837316-53837338 TGTTTGGTGGTCTCTTCACACGG 0: 1480
1: 638
2: 165
3: 77
4: 177
1168052136_1168052143 22 Left 1168052136 19:53837271-53837293 CCTGCACCCATGTGAAATAAACA No data
Right 1168052143 19:53837316-53837338 TGTTTGGTGGTCTCTTCACACGG 0: 1480
1: 638
2: 165
3: 77
4: 177
1168052137_1168052143 16 Left 1168052137 19:53837277-53837299 CCCATGTGAAATAAACAGCCATG No data
Right 1168052143 19:53837316-53837338 TGTTTGGTGGTCTCTTCACACGG 0: 1480
1: 638
2: 165
3: 77
4: 177
1168052139_1168052143 -2 Left 1168052139 19:53837295-53837317 CCATGTTGCTCATACAAAGCCTG No data
Right 1168052143 19:53837316-53837338 TGTTTGGTGGTCTCTTCACACGG 0: 1480
1: 638
2: 165
3: 77
4: 177
1168052138_1168052143 15 Left 1168052138 19:53837278-53837300 CCATGTGAAATAAACAGCCATGT No data
Right 1168052143 19:53837316-53837338 TGTTTGGTGGTCTCTTCACACGG 0: 1480
1: 638
2: 165
3: 77
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168052143 Original CRISPR TGTTTGGTGGTCTCTTCACA CGG Intergenic
Too many off-targets to display for this crispr