ID: 1168052144

View in Genome Browser
Species Human (GRCh38)
Location 19:53837331-53837353
Sequence TCACACGGACGCGCATGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168052138_1168052144 30 Left 1168052138 19:53837278-53837300 CCATGTGAAATAAACAGCCATGT No data
Right 1168052144 19:53837331-53837353 TCACACGGACGCGCATGAAATGG No data
1168052139_1168052144 13 Left 1168052139 19:53837295-53837317 CCATGTTGCTCATACAAAGCCTG No data
Right 1168052144 19:53837331-53837353 TCACACGGACGCGCATGAAATGG No data
1168052142_1168052144 -6 Left 1168052142 19:53837314-53837336 CCTGTTTGGTGGTCTCTTCACAC 0: 1170
1: 1149
2: 398
3: 94
4: 130
Right 1168052144 19:53837331-53837353 TCACACGGACGCGCATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168052144 Original CRISPR TCACACGGACGCGCATGAAA TGG Intergenic
No off target data available for this crispr