ID: 1168054207

View in Genome Browser
Species Human (GRCh38)
Location 19:53852568-53852590
Sequence AAGAAGAAGAAGAAGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168054207_1168054210 28 Left 1168054207 19:53852568-53852590 CCAGCCTTCTTCTTCTTCTTCTT 0: 13
1: 55
2: 313
3: 900
4: 3924
Right 1168054210 19:53852619-53852641 GGAGTCTCTACCTGTCACCCAGG No data
1168054207_1168054209 7 Left 1168054207 19:53852568-53852590 CCAGCCTTCTTCTTCTTCTTCTT 0: 13
1: 55
2: 313
3: 900
4: 3924
Right 1168054209 19:53852598-53852620 TTATCATCATCATTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168054207 Original CRISPR AAGAAGAAGAAGAAGAAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr