ID: 1168058935

View in Genome Browser
Species Human (GRCh38)
Location 19:53879676-53879698
Sequence CCGGAAGAGACTGACCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 23}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168058925_1168058935 28 Left 1168058925 19:53879625-53879647 CCGACCAGAGAGAGGCGGGGACG 0: 1
1: 0
2: 0
3: 16
4: 107
Right 1168058935 19:53879676-53879698 CCGGAAGAGACTGACCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1168058933_1168058935 -7 Left 1168058933 19:53879660-53879682 CCAAGAGGTGTGGAGGCCGGAAG 0: 1
1: 0
2: 0
3: 24
4: 270
Right 1168058935 19:53879676-53879698 CCGGAAGAGACTGACCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1168058924_1168058935 29 Left 1168058924 19:53879624-53879646 CCCGACCAGAGAGAGGCGGGGAC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 1168058935 19:53879676-53879698 CCGGAAGAGACTGACCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1168058927_1168058935 24 Left 1168058927 19:53879629-53879651 CCAGAGAGAGGCGGGGACGCGGG 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1168058935 19:53879676-53879698 CCGGAAGAGACTGACCGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168058935 Original CRISPR CCGGAAGAGACTGACCGCGC CGG Intronic
924635873 1:245787347-245787369 ATGGAAGAGACTGCCCCCGCGGG - Intronic
1077316271 11:1920705-1920727 CCCGAAGAAACTGACCGCATAGG + Intronic
1078508721 11:11969707-11969729 CTGGAAGAGCCTGGCCGGGCAGG + Intronic
1081176273 11:39931245-39931267 CCAGAAGAGACTAACAGAGCAGG + Intergenic
1092958175 12:13569557-13569579 CCGGAAGAGATTGACCCTGCTGG + Intronic
1093926263 12:24911356-24911378 CTGGAAGAGAATGAATGCGCAGG + Intronic
1104828968 12:131734958-131734980 CCGGAAGCGACTGTCCGTGAAGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1138252244 16:55509839-55509861 CAGGAAGAGACTGAGCTGGCTGG + Intronic
1160837555 19:1131920-1131942 CCAGAAGAGACGGACGGGGCGGG + Intronic
1168058935 19:53879676-53879698 CCGGAAGAGACTGACCGCGCCGG + Intronic
1168121947 19:54256618-54256640 CCGGAAGAGACAGAACCCACTGG - Exonic
941444382 2:165582535-165582557 CCGGAAGAAACTGAAGGAGCTGG + Intronic
942565749 2:177264121-177264143 CCGGAAGGGCCGGGCCGCGCCGG + Intronic
948438123 2:237967385-237967407 CCGGCAGTGAGTGACCGCGGCGG + Intronic
1185079187 22:48700360-48700382 CCGTGAGAGCCTGACCTCGCCGG + Intronic
971715071 4:30165706-30165728 CCTGAAGATACTGCCCTCGCTGG - Intergenic
972532871 4:39976982-39977004 CCGGAGGGGACTGGCCGGGCGGG - Intronic
985247906 4:187995596-187995618 CGGGCAGAGAGTGAACGCGCGGG + Intergenic
993899210 5:93572939-93572961 CTGGACTAGGCTGACCGCGCAGG + Intergenic
994897441 5:105723468-105723490 CCAGAAGAGACTGACGGGGTGGG + Intergenic
998951472 5:147396506-147396528 CCAGAGGAGCCTGACCGTGCAGG + Intronic
1002212360 5:177606588-177606610 CTGGAAGAGACTGTCAGAGCAGG - Intronic
1013207355 6:107957506-107957528 CAAGAAGAGACTGAACGTGCGGG - Intronic
1020051219 7:5083031-5083053 CCGGGGGAGACTGACCGCGTGGG - Intergenic
1031482895 7:122300109-122300131 CGGGGAAAGACTGACCGCTCTGG - Intergenic