ID: 1168059310

View in Genome Browser
Species Human (GRCh38)
Location 19:53882449-53882471
Sequence CAGGATCCTGCCTTTCTTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 235}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168059310_1168059327 26 Left 1168059310 19:53882449-53882471 CCCCCAAGAAAGGCAGGATCCTG 0: 1
1: 0
2: 0
3: 29
4: 235
Right 1168059327 19:53882498-53882520 GCTGGTCTGGGCCCCGGCGTAGG 0: 1
1: 0
2: 0
3: 16
4: 164
1168059310_1168059324 14 Left 1168059310 19:53882449-53882471 CCCCCAAGAAAGGCAGGATCCTG 0: 1
1: 0
2: 0
3: 29
4: 235
Right 1168059324 19:53882486-53882508 TCTGGGGCCATGGCTGGTCTGGG 0: 1
1: 0
2: 5
3: 33
4: 344
1168059310_1168059321 4 Left 1168059310 19:53882449-53882471 CCCCCAAGAAAGGCAGGATCCTG 0: 1
1: 0
2: 0
3: 29
4: 235
Right 1168059321 19:53882476-53882498 CTGCTACGTTTCTGGGGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 121
1168059310_1168059323 13 Left 1168059310 19:53882449-53882471 CCCCCAAGAAAGGCAGGATCCTG 0: 1
1: 0
2: 0
3: 29
4: 235
Right 1168059323 19:53882485-53882507 TTCTGGGGCCATGGCTGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 228
1168059310_1168059322 8 Left 1168059310 19:53882449-53882471 CCCCCAAGAAAGGCAGGATCCTG 0: 1
1: 0
2: 0
3: 29
4: 235
Right 1168059322 19:53882480-53882502 TACGTTTCTGGGGCCATGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 105
1168059310_1168059325 20 Left 1168059310 19:53882449-53882471 CCCCCAAGAAAGGCAGGATCCTG 0: 1
1: 0
2: 0
3: 29
4: 235
Right 1168059325 19:53882492-53882514 GCCATGGCTGGTCTGGGCCCCGG 0: 1
1: 0
2: 3
3: 51
4: 367
1168059310_1168059317 -3 Left 1168059310 19:53882449-53882471 CCCCCAAGAAAGGCAGGATCCTG 0: 1
1: 0
2: 0
3: 29
4: 235
Right 1168059317 19:53882469-53882491 CTGGTCCCTGCTACGTTTCTGGG 0: 1
1: 0
2: 1
3: 8
4: 113
1168059310_1168059318 -2 Left 1168059310 19:53882449-53882471 CCCCCAAGAAAGGCAGGATCCTG 0: 1
1: 0
2: 0
3: 29
4: 235
Right 1168059318 19:53882470-53882492 TGGTCCCTGCTACGTTTCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 133
1168059310_1168059316 -4 Left 1168059310 19:53882449-53882471 CCCCCAAGAAAGGCAGGATCCTG 0: 1
1: 0
2: 0
3: 29
4: 235
Right 1168059316 19:53882468-53882490 CCTGGTCCCTGCTACGTTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168059310 Original CRISPR CAGGATCCTGCCTTTCTTGG GGG (reversed) Exonic
900739173 1:4320240-4320262 CAGGAAACTGCCTTACTTGTGGG - Intergenic
902074977 1:13777261-13777283 CACCATCCTGCCTCTCCTGGAGG + Intronic
903032329 1:20472795-20472817 CAGGGTCCTGACTGTCTCGGTGG - Intergenic
903233129 1:21933877-21933899 CAGGAGCCTCCCCTTCCTGGCGG - Intronic
903321496 1:22546067-22546089 CACGATGTTGCCTTTCCTGGGGG - Intergenic
903808769 1:26022982-26023004 CAGGATCCTGGCTTCCATTGAGG + Exonic
904206120 1:28856395-28856417 CAGGACCCTGCATTTCTTCCAGG + Intronic
905130104 1:35748221-35748243 CAGTATTCTTACTTTCTTGGAGG - Intronic
905630928 1:39518278-39518300 CAGGATCTGGCCTTTCCTGCAGG - Intronic
905666832 1:39767898-39767920 CAGGATCTGGCCTTTCCTGCAGG + Intronic
906705733 1:47893873-47893895 CAGGATCCTGGCTTTGGTGATGG + Intronic
906733499 1:48103007-48103029 CAGGATCCCAGGTTTCTTGGGGG + Intergenic
906889381 1:49691506-49691528 CAGTATCCTGTCTGTCATGGTGG - Intronic
907511923 1:54967850-54967872 CAGCATCCTTTCTTTCTTGGTGG + Intergenic
907608633 1:55845010-55845032 CAGGATCCTGACTTTTGTAGTGG + Intergenic
908298356 1:62736151-62736173 CTGGATCCTGCCTATTTTTGTGG + Intergenic
908769093 1:67580307-67580329 AAGGATGCAGCCTCTCTTGGTGG + Intergenic
909043906 1:70686416-70686438 AAGGGGCCTGCCTTTCCTGGTGG - Intergenic
913697686 1:121343573-121343595 CAGGATCCTGGCTTTCCTCCAGG - Intronic
914139870 1:144936478-144936500 CAGGATCCTGGCTTTCCTCCAGG + Intronic
914815052 1:151057166-151057188 CAGGAATCTCCCTTTCTTGCAGG + Intronic
915583355 1:156829511-156829533 CAGGATCCTGCCTTTTTGACAGG + Intronic
916128702 1:161593021-161593043 CGGGATTCTTTCTTTCTTGGTGG - Intronic
916138620 1:161674852-161674874 CAGGATTCTTTCTTTCTTGGTGG - Intronic
916248391 1:162710861-162710883 CAGGGTCCTACCTTTCCTGCAGG + Intronic
916567912 1:165997623-165997645 CTGGCTTCTGCCTTTCTAGGAGG + Intergenic
917664170 1:177207768-177207790 CAGGAACCAGCCTTTTTTGAGGG - Intronic
919988505 1:202692328-202692350 CAAAATGCAGCCTTTCTTGGTGG - Intronic
920485078 1:206362223-206362245 CAGGATCCTGGCTTTCCTCCAGG - Intronic
921214641 1:212926669-212926691 CAGGGTCCTGCTTTTCTTACAGG - Intergenic
1063698098 10:8357149-8357171 CTGGATCCTGCCTTTCTTTTGGG + Intergenic
1065343518 10:24726707-24726729 CAGCATCCTCCCTGTCTTGCTGG + Intergenic
1067076817 10:43192358-43192380 CAGTATCCTGACTTCCTTGTTGG + Intergenic
1067251553 10:44590807-44590829 CAGAACACTGCCTTTGTTGGGGG - Intergenic
1067828622 10:49597318-49597340 CAGGATCCTGGCTTTCTCTGGGG + Intergenic
1068886437 10:62102767-62102789 CAGGATGCTGCTGTGCTTGGAGG + Intergenic
1069586192 10:69604276-69604298 CAGGATTCTTCCTTTCTGTGGGG - Intergenic
1072915283 10:99533839-99533861 CAGGCTCCTGCCCTTTTTGGGGG - Intronic
1076538496 10:131198569-131198591 CAGGAACCTGCCTTGGATGGTGG - Intronic
1076822300 10:132945538-132945560 CAGGACCCCGCCTTTCTGGAGGG - Intergenic
1077037547 11:502689-502711 CAGGATCCTGGCATCCTGGGAGG - Exonic
1077304705 11:1863915-1863937 GAGGCTGCTGCCTTTCCTGGTGG - Intronic
1079523855 11:21361645-21361667 CAGAATCCCACATTTCTTGGAGG + Intronic
1080112743 11:28587046-28587068 CTGGATCCTGCCAGCCTTGGTGG - Intergenic
1081366397 11:42240494-42240516 CTGACTCCTGCCTTTCTTGCCGG + Intergenic
1082265997 11:50119068-50119090 GAGGATGCTGCCTTCATTGGAGG + Intergenic
1082290091 11:50359504-50359526 GAGGATGCTGCCTTCATTGGAGG - Intergenic
1082820466 11:57541380-57541402 CATGCTCCTGCCCTTTTTGGGGG - Intergenic
1083439300 11:62665416-62665438 CAGGACCCTCCTTTTCTTGGCGG + Intronic
1084155911 11:67312342-67312364 GAGGATCCTGCCTGCCTTTGGGG - Exonic
1084221199 11:67680758-67680780 CATGATTCTGCTTTCCTTGGAGG - Intronic
1086482880 11:87262328-87262350 ATGGATACTGCCTTTTTTGGAGG - Intronic
1087094253 11:94305127-94305149 CAGGCTCCTGCCAGACTTGGGGG + Intergenic
1088499197 11:110465722-110465744 AAGGAAGATGCCTTTCTTGGTGG - Intergenic
1088707803 11:112479459-112479481 CAGGATCCTCCCTTTCTCTGAGG - Intergenic
1089779813 11:120865897-120865919 CAGGACGCTTCCATTCTTGGTGG + Intronic
1091098671 11:132848906-132848928 CAACATCCTGCCTTTCGTAGAGG - Intronic
1094160600 12:27385895-27385917 CAGGATCCTGTTCTTCTCGGAGG + Intronic
1095824937 12:46521036-46521058 CAGGATTCTGCCATTATTAGAGG - Intergenic
1097435416 12:59548064-59548086 CATAATCCTGTGTTTCTTGGAGG + Intergenic
1098766616 12:74498356-74498378 AAGGATACAGCCTTTTTTGGTGG + Intergenic
1101988057 12:109462653-109462675 GAAGAGCCTGCCTCTCTTGGGGG - Intronic
1103825787 12:123736926-123736948 CAGGCACCTGCCTATCCTGGTGG - Intronic
1106120916 13:26859648-26859670 CAGCATCCTGTCTTCCTGGGAGG - Intergenic
1106435700 13:29721426-29721448 CAGGGTCCTGCCTGTTTTGCTGG + Intergenic
1106546925 13:30738817-30738839 GAGGAGGCTGCCTCTCTTGGGGG - Intronic
1109498378 13:63205882-63205904 CTGAATCCTGCTTTTCTTGATGG - Intergenic
1110503856 13:76261302-76261324 CATGATTCTGCATTGCTTGGGGG - Intergenic
1111645502 13:91027076-91027098 CAGGATCTTTCCTTTGTTAGAGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1115146101 14:30227990-30228012 CAGGATATTGCTTTTCTTCGGGG - Intergenic
1115341970 14:32302258-32302280 TAGAATCCTGTCTTTCTTTGGGG - Intergenic
1117063214 14:51983516-51983538 CATGATCCTCCCCTTCATGGAGG - Intergenic
1118007979 14:61582405-61582427 CAGCATCCTTCCTTACTTGTTGG + Intronic
1118066372 14:62195621-62195643 GAGGATCCTGCCTTACTAGGTGG + Intergenic
1118880037 14:69818041-69818063 CAGAATCCTTCCTGTCCTGGGGG + Intergenic
1119437279 14:74605667-74605689 CAGGAGCCTGCCTGGCTGGGAGG + Intronic
1120564143 14:86033806-86033828 TAGGATCGTGCCTCTCATGGTGG - Intergenic
1121329483 14:93040913-93040935 CAGGATCCTTCCTTTTTTACAGG - Intronic
1121952921 14:98187644-98187666 GAGGATCCTGGATTTCTTGGTGG + Intergenic
1123405790 15:20018772-20018794 CAGGCTGCAGCCTTTCTGGGTGG - Intergenic
1123515120 15:21025420-21025442 CAGGCTGCAGCCTTTCTGGGTGG - Intergenic
1124441509 15:29689238-29689260 CAGGAGCCTGTCTTTCTAGAAGG + Intergenic
1126440516 15:48683415-48683437 CTGGATCCTTCCTTTCAAGGTGG - Intergenic
1127164653 15:56232034-56232056 CAGGATACAGCCTCTCTTGGCGG + Intronic
1127477699 15:59350240-59350262 CAGGCTCCTGCCTTTCCTCAGGG + Intronic
1131079733 15:89524633-89524655 CAGGATACTCCCATACTTGGAGG + Intergenic
1131833061 15:96366437-96366459 CTGGACCCTGACTTTTTTGGAGG - Intergenic
1137238402 16:46633889-46633911 CAGGAGCCTGCCCTCCTGGGCGG - Intergenic
1141044987 16:80707970-80707992 TAGCATCCTGCCTTTCTTTCTGG - Intronic
1142098299 16:88257544-88257566 CTGGATCCTGCCTTTGGTGCTGG + Intergenic
1142551829 17:745531-745553 GAGGATGCTGTCTCTCTTGGTGG - Exonic
1142599018 17:1044039-1044061 CAGGGTCCGGCCCTTCTTGGCGG - Intronic
1142645525 17:1311713-1311735 CATAATCCACCCTTTCTTGGAGG - Intergenic
1143769393 17:9158380-9158402 CATCATCCTGTCCTTCTTGGAGG - Intronic
1146458857 17:33028046-33028068 CAGGATGCTGCCTTGGTTGCTGG + Intronic
1147050367 17:37789908-37789930 CAGGATCCACGCTTTCATGGGGG + Intergenic
1147363776 17:39947051-39947073 CAGGTTCCAGCATTTCCTGGTGG - Intergenic
1148283782 17:46370318-46370340 CAGGATCCTTCCTCTCCTGCTGG + Intergenic
1148306000 17:46588235-46588257 CAGGATCCTTCCTCTCCTGCTGG + Intergenic
1148344630 17:46895052-46895074 CTGGATCCCACCTTCCTTGGTGG + Intergenic
1149627724 17:58091447-58091469 CTGGGTTCTGCCTTCCTTGGTGG + Exonic
1156407578 18:36797435-36797457 CTGTCTCCTGCCTTTCCTGGGGG - Intronic
1156868731 18:41918712-41918734 CTAGCTCCTGCCTTCCTTGGAGG + Intergenic
1157122075 18:44920519-44920541 CAGGATTCTCTCTTTCTTGCCGG - Intronic
1157131658 18:45013174-45013196 CAGCCTCCTGCCATTCCTGGAGG + Intronic
1157304780 18:46509010-46509032 CAGCTGCCTTCCTTTCTTGGTGG + Intronic
1157905654 18:51567585-51567607 AAGGATCCTGCTTTTCTTTTTGG - Intergenic
1159539767 18:69760703-69760725 TAGGAGCCTGCCTTTCCCGGGGG + Intronic
1159539783 18:69760803-69760825 TAGGAGCCTGCCTTTCCCGGGGG + Intronic
1159539798 18:69760903-69760925 TAGGAGCCTGCCTTTCCCGGGGG + Intronic
1159539814 18:69761003-69761025 TAGGAGCCTGCCTTTCCCGGGGG + Intronic
1159539829 18:69761103-69761125 TAGGAGCCTGCCTTTCCCGGGGG + Intronic
1159615614 18:70575957-70575979 CATGATACTACCTTTGTTGGGGG + Intergenic
1160000597 18:75017405-75017427 CATGACCCTGCCTGTCTTGTAGG + Intronic
1160113920 18:76059137-76059159 CAGGACCCTGCTTCTCATGGGGG - Intergenic
1160211329 18:76882737-76882759 CAGCATCCTGTCTTTCCTTGGGG - Intronic
1161346747 19:3772054-3772076 AGGGATCCTGCCTTCCTTGACGG - Intronic
1162580726 19:11528766-11528788 CAGGATTCTGGGTCTCTTGGGGG + Intronic
1163230599 19:15999035-15999057 CAGGCCCCTGCCTTGCTTGCAGG - Intergenic
1164574725 19:29399063-29399085 CAGGCTTCTGCTGTTCTTGGAGG + Intergenic
1165151096 19:33760666-33760688 CAGGAGCCTTGCTTTCATGGTGG + Intronic
1165555723 19:36630195-36630217 CATTATCCTGCCTTTCTTTTGGG - Intergenic
1165797646 19:38528149-38528171 CAGGACCCTGACTCTGTTGGTGG + Intronic
1168059310 19:53882449-53882471 CAGGATCCTGCCTTTCTTGGGGG - Exonic
925727583 2:6888699-6888721 CAAGATCCTGACTCTTTTGGTGG + Intronic
925922964 2:8650374-8650396 CAGGTCCCAGCCTTTCTTGGCGG + Intergenic
926162525 2:10498986-10499008 CTAGATCCAGCCTTGCTTGGGGG - Intergenic
926356780 2:12047891-12047913 CAGCATTCTGTCTTCCTTGGGGG - Intergenic
927399036 2:22689475-22689497 CAAGGTTCTGCCTTTCGTGGGGG - Intergenic
931459475 2:62437721-62437743 AAGAATCCTTCCTTTCCTGGAGG + Intergenic
933411517 2:81931152-81931174 CAGGATAATGACTTTCTTTGGGG - Intergenic
935266863 2:101402456-101402478 CAGGATCCTGGGCTTCCTGGTGG - Exonic
935413155 2:102787096-102787118 CACGTTCCTGCCTTTAGTGGAGG + Intronic
937117941 2:119422334-119422356 CAGGAAGCTTCCATTCTTGGTGG + Intergenic
940654028 2:156466910-156466932 CAGGCTCCTGCCCTCCTTTGAGG + Intronic
942951902 2:181730913-181730935 CAGCTTCCTGCTTTTCTGGGTGG - Intergenic
946914466 2:224503276-224503298 CTGGGCCCTGCCTTTCATGGGGG - Intronic
947176397 2:227371754-227371776 CAGGATCCCGGCTATCTTGCTGG + Intronic
947709792 2:232306286-232306308 CAGGATCCTGGCTTTATGTGGGG + Intronic
947780539 2:232757110-232757132 CATGATCATGCCAATCTTGGTGG - Intronic
948213805 2:236214346-236214368 CTGGATCCTGCCTTACCTTGGGG + Exonic
1169038974 20:2477045-2477067 CAGGATTGTGCCTTTCTATGTGG - Intronic
1169192920 20:3669284-3669306 CAGGTCCCTGCCTACCTTGGGGG + Exonic
1169337458 20:4768291-4768313 CAGAATACTGTCTTTTTTGGGGG - Intergenic
1169612354 20:7396252-7396274 AAGGATCCTGCCTTTAATGGAGG + Intergenic
1170846810 20:19969029-19969051 CAGGAGGCTGCTGTTCTTGGGGG - Intronic
1172214389 20:33224803-33224825 CTGCATCCTCCCTTTCTTGGGGG - Intronic
1172648225 20:36484693-36484715 CAGGCTCCTGCCTTTCCGAGAGG + Intronic
1172884685 20:38223139-38223161 AAGGAGCCTGCCTTTGTGGGGGG - Intronic
1174482683 20:50842392-50842414 CATGATCCTTCCTTCCTTGCGGG - Intronic
1175219538 20:57409021-57409043 ACGGTTCCTGCCTGTCTTGGGGG + Exonic
1175567095 20:59988997-59989019 CTGGCTGCTGCCTTCCTTGGCGG - Exonic
1178911422 21:36676834-36676856 CAGGATCTTTCCTTTTTTGTTGG + Intergenic
1179164583 21:38925577-38925599 GAGGCTCCTGCCTTCTTTGGCGG + Intergenic
1179984182 21:44912025-44912047 CAGGAGCCTTCCTGTCATGGTGG + Intronic
1180958359 22:19751108-19751130 CAGCCTCCTGCCATTCTTGCTGG + Intergenic
1181407898 22:22697834-22697856 CAGGATGCTGATTTTCATGGAGG + Intergenic
1181486093 22:23232576-23232598 CAGGGTCCTGCCTTTCCAGGTGG - Intronic
1181579473 22:23819727-23819749 CACTATACTGCCTTTCTCGGTGG + Intronic
1184418322 22:44364720-44364742 CAGGATCCACCCTTTCTTCTGGG - Intergenic
1184538379 22:45103172-45103194 CAGGAGCCTGCCTGACCTGGGGG - Intergenic
1184875679 22:47273986-47274008 CAGGCTCCTGCCTCTATAGGAGG - Intergenic
1185221444 22:49630927-49630949 CTGGCTCCTGCCTTCCCTGGGGG - Intronic
1185223839 22:49642184-49642206 CAGGAGCCTGCCTATCTGGGGGG - Intronic
949897218 3:8776870-8776892 CAGAAGCCTGCCTTTCTTCCTGG + Intronic
950349040 3:12328696-12328718 CAGAGCCCTTCCTTTCTTGGGGG + Intronic
950772310 3:15322409-15322431 TAAGATTCTGCCTTGCTTGGGGG - Intronic
950906040 3:16539100-16539122 CAGCATCCTGGCTTTCTTTGAGG - Intergenic
951690879 3:25395561-25395583 CATAATCCTACATTTCTTGGAGG + Intronic
952269522 3:31817658-31817680 CAGGAGCCTGCCCTCCTTGGCGG - Intronic
954538654 3:51379699-51379721 CAGGATCCTTCCTGTGGTGGGGG - Intronic
954856419 3:53647572-53647594 TAGGAACCTGACTTTCTTGTTGG + Intronic
954913000 3:54123792-54123814 GAGTATCCTGCTTTTCTTTGTGG - Intronic
955015612 3:55066155-55066177 CAGGATCCTGTTCTCCTTGGAGG - Intronic
956907993 3:73786822-73786844 GAGGATGCTGCCTTCATTGGAGG + Intergenic
958065530 3:88540804-88540826 TAGGATCCTCCCAGTCTTGGAGG + Intergenic
959634207 3:108543846-108543868 CAGGATCATGCCATTCTGGCAGG + Intergenic
959895023 3:111595530-111595552 CAGGAACATCCTTTTCTTGGTGG - Intronic
960588357 3:119342523-119342545 CAGGATCCAGCCAGTTTTGGGGG - Intronic
961799027 3:129430263-129430285 CAGGAAACTGCCTTTGTTGTAGG - Intergenic
965473912 3:169130567-169130589 CAGGAAGCTGCCACTCTTGGCGG - Intronic
967086056 3:186096292-186096314 CAGGATCCGGCCTTTACTGTGGG + Intronic
967997801 3:195179973-195179995 CTGGAGCCTGCCTGTGTTGGGGG - Intronic
972675794 4:41257851-41257873 CAGGCTCCTCCCTTCCTTGTAGG - Intronic
973696585 4:53496461-53496483 CAGGATCCTGGCTTTTCTGTGGG - Intronic
979395739 4:120187112-120187134 CAGGAATCTGCTTATCTTGGCGG - Intergenic
979970476 4:127128495-127128517 CAGGAGTGGGCCTTTCTTGGTGG - Intergenic
980428551 4:132658822-132658844 CGGGGTCCTGCCCTTCTTGGAGG - Intergenic
982160105 4:152560328-152560350 GAGTATCTTGCCTATCTTGGGGG + Intergenic
985329984 4:188821463-188821485 CACGATCCTGCATTTCTTTCAGG - Intergenic
985706571 5:1405012-1405034 CAGGAGGCTGACTTTCTGGGAGG + Intronic
986309047 5:6537750-6537772 CAGCATCCTTCCCTTCCTGGTGG - Intergenic
986351525 5:6884789-6884811 CAGAATCCTGACTGTCTTTGGGG - Intergenic
987641175 5:20614400-20614422 TAGCATTCTGCCTGTCTTGGGGG + Intergenic
989236820 5:39157786-39157808 CACAATCCTGTCTTTCTTTGAGG - Intronic
989384868 5:40845199-40845221 AAGGATCCTAGCTTTCCTGGTGG + Intronic
992930309 5:81636559-81636581 CAGGATTCTTACATTCTTGGTGG - Exonic
993850823 5:93006388-93006410 TAGAATCCTCCTTTTCTTGGAGG + Intergenic
994731683 5:103499137-103499159 CTGGAGCCCGGCTTTCTTGGCGG + Intergenic
996266286 5:121544376-121544398 CAGAATCCTTCCTTACTTAGGGG - Intergenic
997269437 5:132524536-132524558 CTGGATCCTGCATTCCTTGAGGG - Intergenic
997751159 5:136347125-136347147 CAGGGTCATGCCCTCCTTGGAGG - Intronic
998217072 5:140245521-140245543 CAGAGCCCTTCCTTTCTTGGGGG - Exonic
999468807 5:151832627-151832649 CAGAGTCCTGTATTTCTTGGAGG - Intronic
999640041 5:153663190-153663212 CAGAATCTTACTTTTCTTGGAGG - Intronic
999764801 5:154731599-154731621 CAGATTCCTGCCTGTCTTAGTGG - Intronic
1003953138 6:11137341-11137363 CACTATCTTGCCTTTCTTAGTGG - Exonic
1006620962 6:35363591-35363613 CTGGATCCACCCTTTCCTGGTGG - Intronic
1006981447 6:38151348-38151370 CAGCATCCTGCGCTTCTGGGAGG + Intronic
1008869268 6:56252766-56252788 CAGCATCCTGATTTTCTTTGAGG - Intronic
1012972275 6:105743983-105744005 CAGGATGCCCCCTCTCTTGGGGG - Intergenic
1013371595 6:109475664-109475686 AAGGATCCTAGCTCTCTTGGAGG - Intronic
1013741968 6:113297935-113297957 TAGGATCCTGCCTTTCCAAGTGG + Intergenic
1018134547 6:160767134-160767156 GAGGGTCCTGCCTTTCCCGGCGG + Intergenic
1019706228 7:2498471-2498493 CAGGATCCTGTTCTTCCTGGAGG - Intergenic
1022308662 7:29174431-29174453 CAGGTTCCTGTCCCTCTTGGGGG - Intronic
1022469514 7:30673721-30673743 CAGCATCCTGCATTGCTTGGAGG + Intronic
1022509969 7:30928733-30928755 CAGGATGGGGCCATTCTTGGGGG + Intergenic
1023839457 7:44088240-44088262 CAGCCTCCTGACTTTCTGGGAGG - Intergenic
1024907977 7:54410220-54410242 CTGGACCCTGGCTTTCCTGGAGG - Intergenic
1027177264 7:75912581-75912603 CAGCTTCCTGACTTTTTTGGGGG - Intronic
1029458458 7:100682637-100682659 CAGGCTCCCGCCGCTCTTGGGGG + Exonic
1030306294 7:108021828-108021850 CAAAATCCTTCCTATCTTGGAGG + Intergenic
1031882019 7:127208616-127208638 GAGGATCCTGACTTCCTTGAGGG - Intronic
1032574322 7:133035928-133035950 CTGGATCCAGCCTTTCTTTGCGG - Intronic
1037747190 8:21655210-21655232 CAGGAACCTGCTTATCTTGCCGG - Intergenic
1039024104 8:33239011-33239033 GAAGATCTTGCCTTTCTTGGTGG - Intergenic
1040666116 8:49635513-49635535 AAGGATCCTGCATATCTTGGGGG + Intergenic
1043283110 8:78494205-78494227 CGGGATCCTGGATTTCTTGCTGG - Intergenic
1044092882 8:88024063-88024085 CAGGATCCTCACTTTCTTGTTGG + Intergenic
1044820372 8:96152319-96152341 AAGGATCCAGCCCTTCTTGCAGG + Intronic
1045063487 8:98427040-98427062 CGGGTTCCTGCCTCTCTGGGTGG + Exonic
1047754758 8:127909904-127909926 CATGATGCTCCTTTTCTTGGTGG + Intergenic
1048491202 8:134895519-134895541 CTGGATCCAGCCTTACCTGGAGG - Intergenic
1049628847 8:143640302-143640324 GAGGGTCTTGCCTTTCTTGATGG + Intronic
1050478142 9:6062313-6062335 CATAGTCCTGCATTTCTTGGAGG + Intergenic
1053532118 9:38892935-38892957 GAGGATGCTGCCTTGCTTGCTGG + Intergenic
1053837054 9:42149891-42149913 GAGGTTTCTTCCTTTCTTGGAGG - Intergenic
1054204341 9:62117344-62117366 GAGGATGCTGCCTTGCTTGCTGG + Intergenic
1054634020 9:67471020-67471042 GAGGATGCTGCCTTGCTTGCTGG - Intergenic
1061740094 9:132696592-132696614 CAGGATAGCCCCTTTCTTGGTGG - Intergenic
1061836223 9:133331902-133331924 CAGGATGCGGCCCTTCTTGCGGG + Exonic
1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG + Intergenic
1062323520 9:136002129-136002151 CAGGATCCAGTGTTTCGTGGGGG - Intergenic
1062634932 9:137485786-137485808 GAGGGTCCTGCCTGTCTGGGCGG - Intronic
1203745043 Un_GL000218v1:36829-36851 GAGGTTCCTGGCTCTCTTGGAGG + Intergenic
1203565065 Un_KI270744v1:82655-82677 GAGGTTCCTGGCTCTCTTGGAGG - Intergenic
1186913955 X:14199908-14199930 CATAATCCTGGCTTTCTTGAAGG + Intergenic
1186919367 X:14261361-14261383 CAGCACCTTGGCTTTCTTGGTGG + Intergenic
1187850224 X:23584267-23584289 CAGCATCTTGGCCTTCTTGGTGG - Intergenic
1188694804 X:33177184-33177206 CAGGCTCCTGGCTTTCTTCAGGG + Intronic
1190582528 X:51902970-51902992 CAGGATCCTGTCCCTCTAGGAGG + Intergenic
1193052153 X:77112843-77112865 CATAATCCTGTATTTCTTGGAGG - Intergenic
1193347220 X:80417971-80417993 CATAATCCTGTATTTCTTGGAGG + Intronic
1193626864 X:83833072-83833094 AAGGATCATGCCTTTCATGAGGG - Intergenic
1193640106 X:84002133-84002155 GATGAGCTTGCCTTTCTTGGTGG - Intergenic
1196673168 X:118390967-118390989 CAGAGTCCTGCTTTTCTAGGAGG + Intronic
1199506074 X:148562896-148562918 CTGGATTGTGCCTTTCTTTGTGG - Intronic
1199975346 X:152891882-152891904 CCGTATGCTGCCCTTCTTGGAGG - Intergenic
1201638146 Y:16148375-16148397 CAGGATCCTGTGATTCTTGTGGG + Intergenic
1202271000 Y:23073851-23073873 CAGCATCCTGGCTTTCTTTGAGG - Intergenic
1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG + Intergenic
1202423995 Y:24707595-24707617 CAGCATCCTGGCTTTCTTTGAGG - Intergenic
1202446794 Y:24962490-24962512 CAGCATCCTGGCTTTCTTTGAGG + Intergenic