ID: 1168060276

View in Genome Browser
Species Human (GRCh38)
Location 19:53888071-53888093
Sequence AGAACAGCAGCCTCTGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 309}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168060272_1168060276 30 Left 1168060272 19:53888018-53888040 CCACAGCCTCCGTGCTGTCTCCT 0: 1
1: 0
2: 2
3: 47
4: 441
Right 1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG 0: 1
1: 0
2: 0
3: 31
4: 309
1168060273_1168060276 24 Left 1168060273 19:53888024-53888046 CCTCCGTGCTGTCTCCTTTTTAA 0: 1
1: 0
2: 1
3: 13
4: 212
Right 1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG 0: 1
1: 0
2: 0
3: 31
4: 309
1168060274_1168060276 21 Left 1168060274 19:53888027-53888049 CCGTGCTGTCTCCTTTTTAACAG 0: 1
1: 0
2: 1
3: 27
4: 335
Right 1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG 0: 1
1: 0
2: 0
3: 31
4: 309
1168060275_1168060276 10 Left 1168060275 19:53888038-53888060 CCTTTTTAACAGCGACGTTCACT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG 0: 1
1: 0
2: 0
3: 31
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168060276 Original CRISPR AGAACAGCAGCCTCTGTCTG TGG Intronic
900352129 1:2240171-2240193 AGGACAGCAGCCTCTGTGGTGGG - Intronic
901311026 1:8269843-8269865 AGCACAGGAGCCTCTGACTATGG - Intergenic
901454138 1:9353617-9353639 AGATCAGAACCCTCTGTCTATGG + Intronic
901924004 1:12554544-12554566 AGGGCACCAGCCCCTGTCTGAGG + Intergenic
903026605 1:20433887-20433909 AGCACAGCAGCTTCTGCCTCTGG - Intergenic
903449219 1:23441547-23441569 AGAGCAGTAGCCTCACTCTGTGG + Intronic
903754865 1:25653661-25653683 ACCACAGCAGCCTCGTTCTGGGG - Intronic
904489379 1:30848934-30848956 ATAACAGCATCTACTGTCTGAGG - Intergenic
905883878 1:41481401-41481423 AAAAAAGCTGCCTCTTTCTGGGG - Intronic
906352777 1:45078479-45078501 AGAACAAGAGTCTCTGCCTGTGG - Intronic
908984602 1:70002103-70002125 AGAACATAAGGCTCAGTCTGTGG - Intronic
909112910 1:71502893-71502915 AGAATCGCTGCCTCTGTCTCTGG - Intronic
911161318 1:94685422-94685444 AGGGCAGCAGCCTCAGTGTGTGG - Intergenic
911655111 1:100435047-100435069 GGCCCAGCAGCCTGTGTCTGTGG + Intronic
912312186 1:108633896-108633918 AGACCAGCAGGCTGTGTTTGGGG + Intronic
912562478 1:110560663-110560685 AGAACATCAGGCTCTGGGTGAGG + Intergenic
913247286 1:116881291-116881313 AAAAAAGCAGTCTCTATCTGAGG - Intergenic
914850044 1:151307590-151307612 AGGACAACAGCCTGTGTGTGGGG + Exonic
915641420 1:157230072-157230094 AGAGCAAGACCCTCTGTCTGAGG + Intergenic
917969301 1:180196916-180196938 TGGACATCAGCCTCTGTGTGGGG + Exonic
918439913 1:184556439-184556461 AGAACAGGAGCCTCTGCCAGAGG + Intronic
920100995 1:203516961-203516983 AGAACAGCAGCCATTCTCTCTGG + Intergenic
920653532 1:207856522-207856544 AGAACTGCAGGCTGTGGCTGAGG - Intergenic
921393482 1:214642460-214642482 TGAACAGCACCCTGTGTCTTTGG + Exonic
921847741 1:219901994-219902016 AGATCAGCAGCTGCTGACTGTGG + Intronic
924928536 1:248706615-248706637 CGGTCATCAGCCTCTGTCTGTGG + Intergenic
1064023195 10:11825584-11825606 GCATCAACAGCCTCTGTCTGCGG + Intronic
1065907683 10:30272581-30272603 AAAGCAGCAGCCTCAGTCAGGGG + Intergenic
1066352701 10:34651477-34651499 AGAGCAGTAGTCTCTGTCTAGGG - Intronic
1067156583 10:43786076-43786098 AGCACAGGAGCCTCACTCTGAGG + Intergenic
1067163208 10:43844407-43844429 GGTACAGCAGCCTCTGTGAGAGG - Intergenic
1069080973 10:64087863-64087885 TGACCAGCAGCCTCTTTCTTTGG - Intergenic
1069567743 10:69474807-69474829 CCAGCAGCATCCTCTGTCTGGGG - Intronic
1069829248 10:71272435-71272457 ACCACAGCAGCCTCCCTCTGAGG + Intronic
1071302969 10:84270729-84270751 AGAACAACACCTGCTGTCTGTGG - Intergenic
1071393409 10:85197927-85197949 TGAACAGCAGCCTCTTTTAGTGG - Intergenic
1071480740 10:86062856-86062878 CTAACAGCAGCCTCTCACTGGGG + Intronic
1073142966 10:101261199-101261221 AGGCCAGCAGCCTCTGGCCGCGG - Intergenic
1074684715 10:115949871-115949893 AGAGCAGCTGCTGCTGTCTGTGG - Intergenic
1076069912 10:127480846-127480868 AGAACAGCCGCTCATGTCTGTGG - Intergenic
1077492038 11:2865801-2865823 AGGATAGCAGCATCTATCTGGGG + Intergenic
1077783278 11:5355167-5355189 AGGATAGGAGCCTCTGTCTAAGG + Intronic
1078617853 11:12881742-12881764 GGAACAACTGCCTCTGCCTGGGG + Intronic
1079077730 11:17394343-17394365 AGAACAGCTGCCTCTGTCCCTGG + Exonic
1080776687 11:35393289-35393311 AGAGCAGCAGCCTCTCTGTAAGG + Intronic
1083557763 11:63645464-63645486 AGCACAGCAGCCTCAGTCAATGG - Intronic
1085172213 11:74459054-74459076 AGAACAGCAGCTTGGGCCTGAGG + Intronic
1086222320 11:84463226-84463248 AGTAAACAAGCCTCTGTCTGAGG - Intronic
1086532329 11:87800840-87800862 AAGACAGCAGCCTCGGTCAGGGG - Intergenic
1087327189 11:96738569-96738591 CCAGCAGCAGCCTCTGCCTGAGG - Intergenic
1087837845 11:102892497-102892519 AGGGCACCAGCCACTGTCTGAGG + Intergenic
1091254107 11:134168586-134168608 AAAACAGCCGCTTCTCTCTGTGG + Exonic
1091653763 12:2329161-2329183 AGACCAGCAGCATCGATCTGCGG - Intronic
1091779457 12:3204779-3204801 AGAACAGGATCCTCAGTATGGGG - Intronic
1092913093 12:13165479-13165501 TGAACAGCAGCCACAGTGTGGGG + Intergenic
1092933407 12:13338300-13338322 AGAACAGCAACCTGTGACTGAGG + Intergenic
1095488525 12:42708676-42708698 AAGACAGCAGCCTCAGTCAGGGG + Intergenic
1095683503 12:45005579-45005601 AGAAAAGCATGCTGTGTCTGAGG - Intergenic
1095938266 12:47708471-47708493 TAACCAGCAGCCTCTGTCAGGGG + Intergenic
1096516953 12:52161840-52161862 AGATCAACGGCCTGTGTCTGGGG + Intergenic
1098405742 12:70123967-70123989 AGTACAGGAGCCTCTCCCTGTGG - Intergenic
1099450570 12:82802197-82802219 AGAACAGCAGCTGCTGGCTCAGG + Intronic
1099659403 12:85536049-85536071 AGAACAGCAGATTATGTCAGAGG - Intergenic
1100164420 12:91900443-91900465 AGCACAGGAGCATCTGCCTGTGG + Intergenic
1101305421 12:103522883-103522905 AGCAGAGTAGCCTCTGACTGTGG - Intergenic
1101829368 12:108245406-108245428 ACACCAGGTGCCTCTGTCTGAGG - Intronic
1102101789 12:110284185-110284207 AAAACAGCAGCCATTTTCTGGGG - Intronic
1102944887 12:116977671-116977693 AGAACACTGGCCTCAGTCTGAGG + Intronic
1104224019 12:126813468-126813490 ACAACAGCAGCGTTTGTATGTGG + Intergenic
1105568400 13:21575219-21575241 AGAACAGTGGCCACTGTCAGGGG + Intronic
1105776808 13:23669958-23669980 AGAGCAGCAACCTCTTTGTGGGG - Intronic
1107076249 13:36324094-36324116 AGAATAGCAGGCACTGTTTGTGG - Intronic
1108856527 13:54799900-54799922 AGCACAGCAGCTGCTGGCTGAGG + Intergenic
1110963521 13:81660921-81660943 AGAACAGGAGACTCTCTCTGGGG - Intergenic
1111816817 13:93164140-93164162 AGAACATCAGCCTGTGTCTCAGG + Intergenic
1111957025 13:94770468-94770490 AGAAAAGCAGCCTCAGTTAGTGG - Intergenic
1112373851 13:98820543-98820565 GGAACAGCCTCCTCTGTCTATGG - Intronic
1112377448 13:98856489-98856511 GAAACAGCAGCTTCTGGCTGAGG - Intronic
1113448647 13:110389717-110389739 TGAACAGCAGCCTGCTTCTGGGG - Intronic
1113514390 13:110881361-110881383 ATATCAGAAGCCTCTGTCAGAGG - Intronic
1114364223 14:22009926-22009948 AGAACAGTAGCTTCTGTGTATGG - Intergenic
1114979362 14:28143631-28143653 TGACTAGTAGCCTCTGTCTGAGG + Intergenic
1117449049 14:55833129-55833151 ACAAGAGCAGGCTCAGTCTGGGG - Intergenic
1119646620 14:76353096-76353118 AGAAAAGCTGCCTCGCTCTGCGG + Intronic
1121524099 14:94606544-94606566 AGAAGAGCAACCTCTGTAGGAGG - Intronic
1121659599 14:95624871-95624893 AGAACACCACCCTGTCTCTGGGG - Intergenic
1121699236 14:95939650-95939672 AATACAGCAGTCTCTGTCTCTGG + Intergenic
1122616189 14:103019547-103019569 AGCACAGCTGCCTGTGTCTATGG + Intronic
1122725372 14:103747114-103747136 TGAACAGTGTCCTCTGTCTGTGG - Intronic
1124630282 15:31332577-31332599 AAACCAGTAGCCTGTGTCTGGGG + Intronic
1126981418 15:54248354-54248376 AGAACGGGAGACTCTGTCTGTGG + Intronic
1128674978 15:69602061-69602083 AGAACAGAGGTCTCTCTCTGAGG - Intergenic
1129461617 15:75702707-75702729 AGAAAAGCAGTCTCTGGCTCTGG - Intronic
1129723234 15:77889139-77889161 AGAAAAGCAGTTTCTGGCTGGGG + Intergenic
1131407115 15:92174280-92174302 ACAACAGCAGGCTGTTTCTGTGG + Intergenic
1131703809 15:94970970-94970992 GTGAAAGCAGCCTCTGTCTGCGG - Intergenic
1132509199 16:328858-328880 GGAGCAGCAGCTTCAGTCTGTGG - Intronic
1132965131 16:2649257-2649279 AGAACAGCGGCCTCCCCCTGAGG - Intergenic
1133282778 16:4676555-4676577 AGAACAGCAGTCTCTGCCCTCGG - Intronic
1133599623 16:7326431-7326453 CGAACAGCAACATCTGTATGGGG + Intronic
1133748019 16:8702139-8702161 AGTATAGCAGCTTCTGTTTGTGG + Intronic
1134247805 16:12552969-12552991 AGTGCAGCAGGCACTGTCTGAGG + Intronic
1135055390 16:19227730-19227752 GGAACAGAACCCTCTGTATGTGG - Intronic
1135923580 16:26672851-26672873 AGAACTGCTGCCTGTGACTGTGG - Intergenic
1137037823 16:35581068-35581090 AGTCCAGCTGCCTCTGGCTGAGG - Intergenic
1137719896 16:50621822-50621844 TGAACAGCACCCTCTGTGGGAGG + Intronic
1138385376 16:56632630-56632652 AGAAAAGCAGCCGCAGGCTGTGG + Exonic
1139379924 16:66524193-66524215 AGAACAAGAGCCTCGGCCTGAGG - Intronic
1139547626 16:67657072-67657094 CGAAGAGCAGCCTCTGCCAGGGG + Intronic
1139780786 16:69349740-69349762 AGCACAGCGGTCTCTGTCTGGGG + Intronic
1140151654 16:72373317-72373339 AGAACAGCAGACTGTCTCTGGGG - Intergenic
1141544960 16:84760514-84760536 AGAAGTGAAGCCACTGTCTGAGG + Intronic
1141764707 16:86050949-86050971 GGAACATCAGCCACTGTTTGTGG - Intergenic
1141807807 16:86353637-86353659 AGAACACCAGCCAGTGGCTGAGG + Intergenic
1141944374 16:87299212-87299234 GGACCAGCAACCTCTTTCTGGGG - Intronic
1143376327 17:6469699-6469721 AAAACAGCAGCCTCAGCCTCAGG + Intronic
1147167193 17:38599815-38599837 GGAACAGCAGCCTGGGTATGGGG + Intronic
1147560610 17:41506695-41506717 AGCAAAGCAGCCTCTAGCTGAGG - Intergenic
1148133215 17:45274677-45274699 ACAGCAGCAGCCTCTGTGTGTGG - Intronic
1148679392 17:49465011-49465033 GGGACAGCAGGCTCTGTCTTGGG + Intronic
1148838628 17:50479926-50479948 AGGACAGCAGCCACCGTGTGGGG - Exonic
1149333536 17:55610423-55610445 TTAACTGCAGCCTGTGTCTGAGG - Intergenic
1150436879 17:65160768-65160790 AGCACAGCAGCCTCAGGCTTAGG + Intronic
1150714735 17:67562241-67562263 TGAACAGAAGCCTCTGTGTAGGG + Intronic
1150879646 17:69009406-69009428 AGAACATCAGCCTCTTTCCACGG - Intronic
1151524804 17:74657672-74657694 AGAACAGCAGCTGCAGGCTGTGG - Intergenic
1154195491 18:12263072-12263094 AGAAAAGCAGCATCTCACTGGGG + Intronic
1156383323 18:36583503-36583525 AGAGGAGAAGCCTCTGGCTGGGG + Intronic
1157749830 18:50168459-50168481 GGAACAGCTGCCCCTGTCAGGGG + Intronic
1158399009 18:57104132-57104154 AAAGCAGCAGCCTCAGTCAGGGG - Intergenic
1158454373 18:57593483-57593505 GCACCAGCAGCCTCTGCCTGGGG - Intergenic
1160880010 19:1315465-1315487 CTCACAGCGGCCTCTGTCTGTGG - Intergenic
1162602476 19:11679376-11679398 AGCACAGTAGCTTCTGTCTCTGG + Intergenic
1163260423 19:16186339-16186361 AGCACTGCAGCCTCTGCCTCCGG + Intronic
1163276012 19:16284688-16284710 AGAGCAAAAGCCTGTGTCTGGGG + Intergenic
1163725801 19:18922412-18922434 TGAACAGCAGTGTCTGCCTGCGG - Exonic
1166700518 19:44879214-44879236 AGAAAGGCAGCCTCTGTCCTGGG - Intronic
1167029957 19:46951767-46951789 AGACCAGGAGCCTCTGCATGGGG - Intronic
1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG + Intronic
925926021 2:8671290-8671312 AAAGCAGCAGTCTCCGTCTGAGG + Intergenic
927033046 2:19142258-19142280 TGTACACAAGCCTCTGTCTGAGG + Intergenic
927096559 2:19751594-19751616 AGAGCAGCAGCCTCAGACTTGGG - Intergenic
927197396 2:20558037-20558059 TGAAAAGTAGCCTCTATCTGGGG - Intergenic
927502245 2:23590628-23590650 GGATCCGCAGCCTCTGTGTGTGG - Intronic
927617741 2:24616588-24616610 AGAACTGCTGCCTCTGTTTTGGG - Intronic
928659921 2:33491838-33491860 AGCACAGCAGCCCGTGGCTGAGG + Intronic
928935917 2:36677907-36677929 GGATCAGAAGCCTGTGTCTGGGG + Intergenic
929564911 2:42978268-42978290 AGCTCACCAGCCTCTGTCTTAGG + Intergenic
931798011 2:65730524-65730546 GGCTCAGCAGCCTTTGTCTGTGG - Intergenic
932703338 2:74005163-74005185 GGAAAACCAGCCTCTATCTGGGG - Intronic
932921095 2:75916382-75916404 GGCACAGGAGCCTCTCTCTGTGG + Intergenic
933841746 2:86292599-86292621 AGCACAGAACCCTCTGGCTGGGG - Intronic
933898382 2:86832092-86832114 AGAGCAGCACACTCTATCTGGGG + Intronic
934144823 2:89081605-89081627 AGATCAGTGGCCTCTGTCTTTGG - Intergenic
934224434 2:90118946-90118968 AGATCAGTGGCCTCTGTCTTTGG + Intergenic
935987457 2:108688747-108688769 ATAAGACCAGCCTGTGTCTGTGG + Intergenic
939289972 2:140181571-140181593 ATAATAGCAGCCTCTGACTGAGG + Intergenic
939782364 2:146464987-146465009 ACAACTGCTGCCTCTGCCTGAGG - Intergenic
940108714 2:150127021-150127043 ATTACAGCTGCCTCTGTATGTGG + Intergenic
940161288 2:150716492-150716514 AGAAAAGCAGCCACTGACTATGG - Intergenic
940433538 2:153623113-153623135 GGAAAAACAGCCTCTGTCTCAGG - Intergenic
941619406 2:167759204-167759226 AGACCAGCAGCATATGACTGTGG + Intergenic
943409827 2:187533049-187533071 AAAACAGCAGCCCCAGTCAGGGG + Intronic
943599109 2:189892889-189892911 AAGGCAGCAGCCTCTGTCAGGGG - Intronic
946079783 2:217107605-217107627 ATAGCAGCAGCCTCTTTCTGTGG - Intergenic
946126471 2:217567395-217567417 ATATCAGCATCCTCTGTCTCAGG + Intronic
946804087 2:223452305-223452327 AGAAGCAAAGCCTCTGTCTGTGG + Intergenic
947750322 2:232528729-232528751 AGGGCAGGGGCCTCTGTCTGAGG - Intronic
947875526 2:233465037-233465059 ACAACAGCACCCTCTTTCCGGGG + Intronic
948364612 2:237446515-237446537 CCAACAGCAGACTCTGGCTGGGG - Intergenic
948436447 2:237956822-237956844 AGAGCAGCAGCTGGTGTCTGTGG + Intergenic
949062308 2:241968561-241968583 GGAGCAGCAGCCTCAGCCTGTGG + Intergenic
1170048821 20:12116755-12116777 ATAACAGCAGCAGCTGGCTGGGG - Intergenic
1170214515 20:13877154-13877176 ATAACAGCAGCCTTTATCTGGGG - Intronic
1171059899 20:21946029-21946051 AGAACAGTGTCCTCTTTCTGAGG + Intergenic
1173908709 20:46648076-46648098 AGTCCACCAGCCTCTGTTTGGGG + Intronic
1174163388 20:48567532-48567554 GGAGCTGCAGCCTGTGTCTGGGG - Intergenic
1174296359 20:49548060-49548082 TGAACAGCAGCCGCTCTCAGTGG + Intronic
1174358598 20:50014452-50014474 AGACCAGCAGCCACTGGCCGAGG - Intergenic
1174571702 20:51506704-51506726 TGAACATCAGCCTCGGCCTGCGG + Intronic
1174755945 20:53158604-53158626 AAAACAGGAGCCACTTTCTGGGG - Intronic
1175865233 20:62172402-62172424 AGGACATCAGCATCTCTCTGGGG + Intronic
1177483720 21:21728021-21728043 AGTTCAGCAGCCTCTTTCAGCGG - Intergenic
1177694606 21:24555320-24555342 AAAACAGCAGCCCCAGTCAGGGG + Intergenic
1178664509 21:34534662-34534684 TGAAGGGCAGCCTTTGTCTGTGG + Intronic
1179397834 21:41057448-41057470 AGAAACGAAGCCTCTGTCAGTGG - Intergenic
1179727984 21:43350835-43350857 AGGACAGCAGGCTCAGTGTGAGG - Intergenic
1180076735 21:45467014-45467036 TGGACGGCGGCCTCTGTCTGAGG + Intronic
1180255712 21:46625938-46625960 ATAAAAGCAGCCTGTGTTTGTGG - Intergenic
1180731473 22:17985534-17985556 TGAGCAGTAGCCTCTGCCTGGGG + Intronic
1181015164 22:20064386-20064408 AGAGCAGCAGCCTCAGTCTTGGG - Intronic
1181136738 22:20772415-20772437 CAGACAGCAGCCTCTGCCTGTGG + Intronic
1181169374 22:20999693-20999715 GGAGCTGCAGCCACTGTCTGGGG + Intronic
1181516507 22:23416755-23416777 TGAGCAGTAGCCTCTGCCTGGGG + Intergenic
1181520640 22:23447667-23447689 AGCAGGGCAGCGTCTGTCTGGGG + Intergenic
1181980171 22:26760516-26760538 ACAACATCAGCCTCCATCTGGGG - Intergenic
1182947727 22:34340529-34340551 ACAACAACAGACTCTCTCTGAGG - Intergenic
1183627735 22:39014907-39014929 AGAGGAGGAGCCTGTGTCTGGGG - Intronic
1184690468 22:46115064-46115086 AGAGCAGCCCCCTCTGTCTCCGG + Intergenic
1184790501 22:46696800-46696822 AGAGCTGCAGCCACTGCCTGTGG + Intronic
1184946969 22:47810731-47810753 GGAACAGAAGCCCCTGGCTGTGG - Intergenic
949454622 3:4225528-4225550 AGAACAGCAGCTTCAGTCTATGG + Intronic
949583398 3:5413004-5413026 AAAGCAGCAGCCTCAGTCAGGGG + Intergenic
950788116 3:15452409-15452431 TGAACAGCAGCCTGTGAATGGGG + Intronic
953816712 3:46163814-46163836 AGCAGAGCAGCGTCAGTCTGTGG - Intronic
954327801 3:49873071-49873093 CCCACAGCAGCCACTGTCTGTGG + Intergenic
954386400 3:50246274-50246296 AGAAAAGCAGCCTCAGCCAGGGG - Intronic
954449866 3:50566048-50566070 AGCCCTGCATCCTCTGTCTGTGG + Exonic
954520991 3:51226211-51226233 AGAACAGCAGACTCAGGCCGTGG + Intronic
954971643 3:54656401-54656423 AGACCAGCAGCCTCTGTTGGAGG - Intronic
955898633 3:63727486-63727508 AGAACAGCAGCATCTGTGCTAGG + Intergenic
958265839 3:91435937-91435959 AGCACAGTACCCTCAGTCTGTGG - Intergenic
960756192 3:121015984-121016006 ACAAGTGCAGACTCTGTCTGAGG + Intronic
961168801 3:124781240-124781262 AGGACTGCGGCCTCTGTCTGGGG + Intronic
961701630 3:128749042-128749064 AAAACAGCAGACTCTGGCTTTGG - Intronic
961903462 3:130237967-130237989 AGGACAGCAAATTCTGTCTGGGG - Intergenic
962132999 3:132702310-132702332 ATAACAGCAGGTTTTGTCTGGGG + Intronic
962166588 3:133055634-133055656 AGAGGAGCTGCCTCTTTCTGTGG - Intronic
962180037 3:133197179-133197201 AAAACAGAAGCCACTCTCTGAGG + Intronic
962343335 3:134602794-134602816 AGAGCTGCAGCCTTGGTCTGAGG - Intronic
964728890 3:159844044-159844066 AGAAAGGCAGCCTCTGGCAGGGG - Intronic
964961103 3:162427726-162427748 GGCACAGCAGCCTCTCCCTGTGG - Intergenic
965031362 3:163372086-163372108 GGAACAGCATTCTCTGACTGTGG + Intergenic
967104311 3:186242913-186242935 AGATCAGGAGCCTGTGTCTGGGG + Intronic
968123930 3:196144586-196144608 AAAACACCAGCCTCTGCCCGAGG - Intergenic
968123935 3:196144621-196144643 AAAACACCAGCCTCTGCCCGAGG - Intergenic
968123940 3:196144656-196144678 AAAACACCAGCCTCTGCCCGAGG - Intergenic
968222916 3:196951680-196951702 AGAGCAGCAGCCTCTCTCTCTGG - Intronic
968516627 4:1018223-1018245 GAAAGAGGAGCCTCTGTCTGGGG + Intronic
969243421 4:5916808-5916830 AGGACAGGAGCCTCTGCTTGAGG + Intronic
969460450 4:7326212-7326234 AGGACAGAACCCTCTGTCTTAGG - Intronic
970454120 4:16205085-16205107 AAAACGCCAGCCTCTTTCTGTGG + Intronic
972465175 4:39348807-39348829 AGGACAGCTGCCTGTGACTGTGG + Intronic
973729569 4:53810644-53810666 AGAACTGCGGCCTCAGCCTGGGG - Intronic
976610620 4:87026516-87026538 CAAACAGCAGTCTCTGTGTGGGG + Intronic
977492372 4:97731645-97731667 CCAACTGCAGCCTCTGCCTGAGG - Intronic
977641445 4:99362036-99362058 AGAACTGCAGCCACAGGCTGAGG + Intergenic
978102587 4:104860731-104860753 AGAACTGCAGCCTTTTTCTCTGG + Intergenic
978178074 4:105758561-105758583 AGCACAGCAGCATCTGCCTCTGG - Intronic
978584707 4:110264920-110264942 AGAAAAGCAGAGTCTGTCCGAGG - Intergenic
979253455 4:118588728-118588750 AGAAAAGCAGCATCTGTCAATGG - Intergenic
981110939 4:140932665-140932687 ATAACAGCAGCACCTATCTGAGG + Intronic
982738799 4:159036375-159036397 AGAGCTGCCTCCTCTGTCTGAGG + Intronic
983153055 4:164309485-164309507 AGCACAGCATCCTCAGTCAGGGG + Intronic
983167672 4:164497372-164497394 AAGACAGCAGCCGCTGTCAGGGG - Intergenic
985479848 5:102636-102658 AGCACGGCAGCCTCTGCCTCTGG - Intergenic
985524626 5:395741-395763 AGGACAGCAGCCTGTGGCGGAGG - Intronic
986216060 5:5720199-5720221 AGAACAGAAGCATCAGACTGGGG + Intergenic
987070955 5:14336574-14336596 AGAACAGCTGGCTCAGACTGGGG + Exonic
987260175 5:16195269-16195291 GGATCAGCAGCATCAGTCTGTGG + Intergenic
987371873 5:17200990-17201012 AGAATAGCAGTATCTATCTGTGG - Intronic
990208130 5:53452261-53452283 AGAACAGCGAACTCTTTCTGTGG + Intergenic
991971580 5:72146840-72146862 ATAGCATCAGCCTCTTTCTGGGG + Intronic
992434115 5:76738900-76738922 AGAACAGGAAGCTCTGTGTGAGG + Intergenic
994032466 5:95159965-95159987 AGAACAGCATGCTATGTTTGGGG + Intronic
994084969 5:95748363-95748385 AACACAGCTCCCTCTGTCTGAGG - Exonic
994641994 5:102421605-102421627 AAAGCAGCAGCCCCAGTCTGGGG + Intronic
997303860 5:132824792-132824814 ATCACCGCAGCCTCTTTCTGAGG + Exonic
997516344 5:134492439-134492461 AGCACAGACGCCTCTGGCTGCGG - Intergenic
999199322 5:149804809-149804831 GGAACACAACCCTCTGTCTGGGG - Intronic
999374767 5:151079207-151079229 AGGACAGCAGCCTTGGTCAGGGG + Intronic
1002309607 5:178306576-178306598 AGAGCAGCCCCCTCTCTCTGAGG - Intronic
1002713776 5:181212129-181212151 AGAACACCAGCATGTGACTGAGG - Intergenic
1005912350 6:30322183-30322205 AGATCAGGAGCTTTTGTCTGTGG - Intergenic
1007284201 6:40736143-40736165 AGAGCAGCACCCCCAGTCTGGGG + Intergenic
1007302769 6:40880517-40880539 AGTGCAGCAGACTCTGTCTTTGG + Intergenic
1007665833 6:43512512-43512534 AGAGGAGCAGCCGCTGTGTGGGG + Exonic
1007794671 6:44337870-44337892 AGGACAGCAGCTTCTGTGAGTGG - Intronic
1008425195 6:51348963-51348985 AGGGCAGCAGCCTCAGTCAGTGG - Intergenic
1008989521 6:57586699-57586721 AGCACAGTACCCTCAGTCTGTGG + Intronic
1009178106 6:60485255-60485277 AGCACAGTACCCTCAGTCTGTGG + Intergenic
1011154955 6:84320491-84320513 TGAAAAGCAGCTTCTGCCTGAGG - Intergenic
1011260060 6:85461503-85461525 AAGAAAGCAGCCTCTGTCTCAGG - Intronic
1012291577 6:97461898-97461920 AGGACTGCAGCCTCTGTGGGAGG - Intergenic
1015862100 6:137691894-137691916 AGAACTACAGCCTCTCTCTATGG + Intergenic
1015917446 6:138231939-138231961 AGAACAGCATCCTCTGTGACAGG + Intronic
1018603369 6:165571207-165571229 AGAACAGCAACCTGAGTCTTTGG + Intronic
1019590602 7:1828580-1828602 AGCAGGGCAGCGTCTGTCTGGGG - Intronic
1019789508 7:3001863-3001885 AGAACAGCAGCCTCACTCCTGGG + Intronic
1020003413 7:4768537-4768559 AGGGCTGCAGCCTCTGCCTGAGG - Exonic
1021843570 7:24742939-24742961 GGGACAGCTGCCTCTGTCTCTGG - Intronic
1023557752 7:41440965-41440987 AGAGCACCAGCCTCTGGATGTGG - Intergenic
1023806381 7:43875822-43875844 AGGATAGCAGCATCTGTCTGAGG - Intronic
1024006666 7:45229341-45229363 CCAGCAGCAGCCTCTGCCTGGGG + Intergenic
1026534676 7:71229889-71229911 AGAGCGGCAGCCTGTGTCTGTGG + Intronic
1028963447 7:96775440-96775462 AGAAGAGCGGCCTCTGTATCTGG + Intergenic
1029619473 7:101680800-101680822 AGGACAGCAGCCCCTGTCCTAGG + Intergenic
1029971117 7:104790357-104790379 AGACAAGCAGGCTCTGTCTATGG - Intronic
1032846348 7:135754931-135754953 AGAACAGCAGCTTATATCCGAGG - Intergenic
1035618363 8:1019278-1019300 AGCTCAGAAGCCTCTCTCTGTGG + Intergenic
1036752080 8:11449741-11449763 GGAACAGCAGTCTCTGTGTGTGG - Intronic
1037768647 8:21786626-21786648 AGAGAAGCTGCCTCTGGCTGAGG + Intronic
1039582868 8:38681246-38681268 AGAACTGCAGCCTGTGTTGGTGG + Intergenic
1041117438 8:54553774-54553796 AGAACAGAAGACTCTGACTTGGG + Intergenic
1042437993 8:68790228-68790250 AGATCATCTGCCTCTGTCTCAGG + Intronic
1043312345 8:78876318-78876340 AGAAAAGAAGCCTCTTCCTGTGG + Intergenic
1044820673 8:96153873-96153895 AGAGCCGCAATCTCTGTCTGCGG + Intronic
1045486242 8:102633806-102633828 GGAACCCCAGCCTCTGCCTGTGG - Intergenic
1046742585 8:117844981-117845003 GGATCAGCAGCCTCAGACTGAGG - Intronic
1047359146 8:124152099-124152121 AGAACATCAGCTTCAGCCTGTGG + Intergenic
1048188203 8:132263747-132263769 AGAACAGCAGCCTCAGTGCTTGG + Intronic
1049735505 8:144202761-144202783 AGAGGAGCACCCGCTGTCTGTGG + Intronic
1052125551 9:24770366-24770388 AGCACAACAGCCTCAGTCTGGGG - Intergenic
1052281186 9:26735227-26735249 AAAGCAGCAGCCTCAGTCAGGGG - Intergenic
1052932860 9:34069968-34069990 AGAACCTCAGCCTCCGTCTCTGG + Intergenic
1053571784 9:39317686-39317708 ATAACAGCACCCTATGTCTGTGG - Intergenic
1053622313 9:39832519-39832541 ATAACAGCACCCTATGTCTGTGG - Intergenic
1053882826 9:42612663-42612685 ATAACAGCACCCTATGTCTGTGG + Intergenic
1053889843 9:42681639-42681661 ATAACAGCACCCTATGTCTGTGG - Intergenic
1054114824 9:61152315-61152337 ATAACAGCACCCTATGTCTGTGG - Intergenic
1054125361 9:61301325-61301347 ATAACAGCACCCTATGTCTGTGG + Intergenic
1054221853 9:62420132-62420154 ATAACAGCACCCTATGTCTGTGG + Intergenic
1054228861 9:62489041-62489063 ATAACAGCACCCTATGTCTGTGG - Intergenic
1054592932 9:67030218-67030240 ATAACAGCACCCTATGTCTGTGG + Intergenic
1055422221 9:76155909-76155931 GAAAGAGCAGCCTCTGACTGGGG + Intronic
1057702877 9:97376351-97376373 CGAACTGCACCCTCTGCCTGGGG - Intronic
1060236869 9:121870467-121870489 AGAACAGCCCCCTCTGGCTTGGG - Intronic
1060861854 9:126961171-126961193 AGAACAGCTGGCTCTGTTTTGGG + Intronic
1061409055 9:130408733-130408755 AGGACAGGAGCCTCTGCATGGGG - Intronic
1061498606 9:130989895-130989917 AGGAGAGCAGCCTCTGTCCCAGG + Intergenic
1061855399 9:133439294-133439316 AGATCAGCTCCCTTTGTCTGTGG + Intronic
1062031592 9:134364440-134364462 TCAACAGCAGCCTTTGTGTGGGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062322385 9:135996760-135996782 ACAGCACCAGCCTCTGTGTGGGG + Intergenic
1062354094 9:136153729-136153751 GGAACAGCAGCCCCTGCCCGAGG + Intergenic
1062447295 9:136600297-136600319 AGCACAGGGGCCTCTGGCTGGGG + Intergenic
1062587522 9:137255901-137255923 AGCACACCATTCTCTGTCTGAGG - Exonic
1186062834 X:5729555-5729577 AGCACAGCAGCCTCTGCTTCTGG + Intergenic
1187936719 X:24343415-24343437 ATCAGGGCAGCCTCTGTCTGGGG + Intergenic
1191097400 X:56688270-56688292 AAGACAGCAGCCTCAGTCAGGGG - Intergenic
1191920009 X:66245967-66245989 GCAACTGCAGCCTCTGCCTGAGG - Intronic
1192180191 X:68911413-68911435 TGCACAGCAGCCTCCTTCTGGGG + Intergenic
1192741058 X:73893016-73893038 AAGACAGCAGCCTCAGTCAGCGG + Intergenic
1192810365 X:74541949-74541971 AGAGCAGAGGCCTCTGTTTGGGG - Intergenic
1193073678 X:77333036-77333058 AGCAAAGCAGCCTCATTCTGTGG - Intergenic
1199021224 X:142880886-142880908 AGAACAGAAGCCTCTGCCACAGG + Intergenic
1199224936 X:145362583-145362605 AGAACAGCAGCCACTTTAAGAGG + Intergenic
1199261614 X:145781092-145781114 TGAAAGGCAACCTCTGTCTGGGG + Intergenic
1199656428 X:149999574-149999596 GCACCAGCAGCCTCTCTCTGAGG - Intergenic
1200257727 X:154593525-154593547 AGCACAGCAGCATCTGTTTCTGG - Intergenic
1200369936 X:155714829-155714851 AGCAGAGGAGCCTCTCTCTGTGG + Intergenic