ID: 1168063289

View in Genome Browser
Species Human (GRCh38)
Location 19:53906157-53906179
Sequence CAGGGGAAACAGGCAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168063289_1168063298 18 Left 1168063289 19:53906157-53906179 CCTCCATTTGCCTGTTTCCCCTG 0: 1
1: 0
2: 4
3: 24
4: 319
Right 1168063298 19:53906198-53906220 GATCTCATGCCTGTGTCTCTTGG 0: 1
1: 0
2: 0
3: 16
4: 236
1168063289_1168063296 -4 Left 1168063289 19:53906157-53906179 CCTCCATTTGCCTGTTTCCCCTG 0: 1
1: 0
2: 4
3: 24
4: 319
Right 1168063296 19:53906176-53906198 CCTGGCTGTTCTTATCTCTCCGG 0: 1
1: 0
2: 0
3: 25
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168063289 Original CRISPR CAGGGGAAACAGGCAAATGG AGG (reversed) Intronic
900570389 1:3355416-3355438 CCTGGGAGACAGGAAAATGGAGG - Intronic
901422528 1:9160775-9160797 CTGGGCAAACAGGCAGATGTGGG - Intergenic
902051701 1:13568204-13568226 GAGGGGAAAGAGGCAGAGGGGGG + Intergenic
902218690 1:14950792-14950814 CAGGGAAAAGATGGAAATGGGGG + Intronic
902938541 1:19782634-19782656 CAGGGGGAAAAGGGAAAGGGAGG + Intronic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
904271854 1:29355415-29355437 AAGGGGATACAGGCACTTGGGGG - Intergenic
904416252 1:30362760-30362782 CAGGGGAAACAGGAGTGTGGAGG - Intergenic
905011184 1:34748038-34748060 AAGGGGAATGAGGCAAAGGGAGG - Intronic
906245521 1:44270811-44270833 CAGGGGAAAGAAGCAAGTGAGGG - Intronic
906246121 1:44275531-44275553 CAGGAGAAACTGCCAAAGGGAGG - Intronic
906775540 1:48526123-48526145 CAGGGGAATCAGGCAAAATGAGG + Intergenic
907334997 1:53694049-53694071 TAGGGGAGACAGGCAACAGGCGG + Intronic
907811946 1:57879767-57879789 CAGGGGACAGAGGCCAATGGAGG - Intronic
907964420 1:59315422-59315444 GAGGGAAAAAAGGGAAATGGGGG - Intronic
909416783 1:75415625-75415647 CAGAGGAAGCAGGAAAATGTGGG + Intronic
910866674 1:91794542-91794564 GAGGGGAAAGAAGGAAATGGAGG - Intronic
911373992 1:97027934-97027956 CAGGGCAATCAGGCAAGAGGAGG + Intergenic
911391896 1:97255760-97255782 CAGGGGAAACTGGTAAGTGGTGG + Intronic
912107302 1:106295488-106295510 CAAAGGAAAAAGGCACATGGAGG - Intergenic
912362458 1:109106211-109106233 CTGGGAAAACCGGCATATGGAGG + Intronic
912393696 1:109322946-109322968 CAGGGAACAGAGGCAGATGGAGG + Exonic
912811623 1:112799397-112799419 CAGGGGAAACAGGCATCAGCTGG - Intergenic
914265816 1:146037714-146037736 GAGGGGGAAGAGGGAAATGGAGG + Intergenic
916217715 1:162411690-162411712 CAGGGAGAGCAGGCAGATGGAGG + Intronic
917510520 1:175665687-175665709 CAGGTGAAACACACAAATGTTGG - Intronic
920110238 1:203582458-203582480 GAGGGGGAACAGGAAAATTGTGG + Intergenic
921589543 1:216987528-216987550 CAGGGGAAGAAGACAAATGAAGG + Intronic
921951790 1:220937696-220937718 CAGAGGGAAAAGGGAAATGGTGG - Intergenic
923212776 1:231820547-231820569 CAGGGGAAAAAGGCAACTCATGG + Intronic
923719682 1:236456251-236456273 CAGAGGAATCAGGGAGATGGAGG - Intronic
924920661 1:248626117-248626139 CAGGGAAACAGGGCAAATGGAGG + Intergenic
1062815298 10:495223-495245 AAGGGGAAACAGGGAGATGCTGG + Intronic
1063614812 10:7592509-7592531 TAGGGGAAAGAGGAAAATAGAGG + Intronic
1065427820 10:25623675-25623697 CAGGGCAATCAGGCAAAAGAAGG + Intergenic
1065624449 10:27616181-27616203 GAGGGGAAAAAAGCAAATGTCGG - Intergenic
1067056216 10:43053169-43053191 CAGTGGAAAAACCCAAATGGAGG - Intergenic
1067178491 10:43967252-43967274 CAAGGGTAAGAGGGAAATGGGGG - Intergenic
1068161085 10:53264947-53264969 CAGGGGAATCAGTCAGAGGGAGG - Intergenic
1068227854 10:54129941-54129963 AAGGAGAAATATGCAAATGGTGG + Intronic
1068786968 10:60987364-60987386 CAGGGGAAAAAGGCAAATTCAGG - Intronic
1070166151 10:73899506-73899528 AAGGGAAAACAGGCATATGGAGG + Intergenic
1070399974 10:76044945-76044967 AAGGGGAAACAAGCAAGAGGGGG - Intronic
1072038653 10:91587209-91587231 AAGGAAAAACAGGCATATGGAGG - Intergenic
1073639796 10:105240143-105240165 CTAGGGAAACAGCCAGATGGAGG + Intronic
1073894016 10:108133008-108133030 CTGGGGAGACAGGCAAGTTGAGG + Intergenic
1074296436 10:112193493-112193515 AAGGGCAAACAGGCAGATGATGG + Intronic
1074538105 10:114343425-114343447 CAGGAGAAACAGGCACTTTGTGG + Intronic
1075782079 10:125023593-125023615 CCGGTGACACAGACAAATGGGGG - Intronic
1078392739 11:10950883-10950905 CAGGAGAACCAGTCAAATGTAGG + Intergenic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079464468 11:20715530-20715552 TAGGGGAAACATGCATAAGGTGG - Intronic
1080008001 11:27429900-27429922 CAGGGGGAACAGTCACATGGAGG - Intronic
1080259890 11:30337035-30337057 CATGGGAAACATGCAAATAGAGG - Exonic
1080400163 11:31927106-31927128 AAGGGGAAGCAGGCACATTGCGG - Intronic
1081390071 11:42518784-42518806 CAGGGAAAACAGGCAGGTGAAGG + Intergenic
1084567978 11:69942407-69942429 CAGGGAAAACCGGCGAAGGGGGG + Intergenic
1084762325 11:71281852-71281874 CAGTGGAAACAGGCCAAGAGAGG - Intergenic
1084842530 11:71867476-71867498 CAGGGTCCACAGGCAGATGGCGG - Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085312528 11:75525112-75525134 CAGGGGAAACAAGCAGAGGCTGG - Intronic
1085818339 11:79765411-79765433 CAGAAGAAACAGGCCTATGGGGG + Intergenic
1086280130 11:85175610-85175632 CAGGGCAAACAGGCAACAGAAGG + Intronic
1086461566 11:87010943-87010965 CAGGGGAAATGGGGAAATGTTGG + Intergenic
1087328461 11:96751890-96751912 CAGGGCAATCAGGCAAAAGAAGG - Intergenic
1087435271 11:98108820-98108842 CAGTGGAAAGAGTCAAATGTAGG - Intergenic
1088599309 11:111461327-111461349 CAGAGGAGACAGGCACGTGGCGG - Intergenic
1088813490 11:113406739-113406761 CAGGGGAAGCAGGAAGCTGGTGG - Intergenic
1089781449 11:120875803-120875825 AAGGGGAAAAAGGGTAATGGCGG - Intronic
1090791621 11:130094854-130094876 CAGATGAAGCAGGGAAATGGAGG + Intronic
1091248717 11:134123321-134123343 CAGGGGAAAAAGGGACATGTAGG + Intronic
1092742341 12:11641897-11641919 CTGGGGAACCAGGAAACTGGTGG - Intergenic
1096045299 12:48556902-48556924 CAAGGGAAAGAGGACAATGGTGG + Intergenic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1097917032 12:65032093-65032115 GGGAGGACACAGGCAAATGGAGG - Intergenic
1098604737 12:72376254-72376276 TGGGGGAAGCAGGAAAATGGAGG - Intronic
1100867034 12:98868055-98868077 CAGAGGAGACAGTCAGATGGAGG - Intronic
1101358085 12:103999561-103999583 TTGGGGCAATAGGCAAATGGAGG - Intronic
1102512470 12:113425103-113425125 AAGGGGAAACAGGCACAGAGAGG + Intronic
1103466348 12:121144916-121144938 CAGGAGAAACAGCCAATTTGGGG + Intronic
1103831118 12:123780112-123780134 GAGGGGAAACTGGCACAGGGAGG - Intronic
1104184540 12:126417232-126417254 CATGGGAAAAATGCAAATTGAGG + Intergenic
1105037316 12:132935175-132935197 CAAGGGACACAGGAAAAAGGAGG + Intronic
1105345475 13:19567324-19567346 CTGGGGAAACAGGTTGATGGAGG + Intergenic
1105984561 13:25552830-25552852 CAGGGGGAGCAGGCATATGCTGG - Intronic
1107158111 13:37193584-37193606 CAGGGGACCCAGGCATGTGGTGG + Intergenic
1107477693 13:40755499-40755521 CTGGGGAAACAGCCTGATGGAGG + Intronic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1108666001 13:52631260-52631282 CTGGGGAAACAGGCTGATGGAGG - Intergenic
1108782254 13:53850458-53850480 CCAGGGACACAGGAAAATGGTGG - Intergenic
1110123006 13:71906523-71906545 CAGGGAACACAGGCAGAGGGTGG + Intergenic
1112325386 13:98440057-98440079 AAGGGGAAACAGGCAAGGGGCGG - Intronic
1112431421 13:99354060-99354082 CAGGGGATGCAGGCAGATCGTGG + Intronic
1115475576 14:33810154-33810176 CAGGTGAAAGAGGCAGGTGGAGG + Intergenic
1116923080 14:50602193-50602215 CTGGGGAAACAAGTAACTGGCGG - Intronic
1119517820 14:75262216-75262238 CAGGGAAACCTGGCAAGTGGAGG - Intronic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1127915376 15:63450820-63450842 CAGGGGAAAGAGTCCAGTGGTGG + Intergenic
1129251941 15:74314060-74314082 CAGGTGATACAGGCATAAGGAGG - Intronic
1129943940 15:79523136-79523158 GAGTGGAATCATGCAAATGGAGG - Intergenic
1130155284 15:81345043-81345065 CAGGGGAGAAAGGAAAATGGCGG + Intronic
1131324509 15:91429561-91429583 CAAGGGAAACAAGCATGTGGTGG + Intergenic
1131574729 15:93576706-93576728 AATGGGAAACAGGTAAATTGAGG + Intergenic
1134238583 16:12487049-12487071 AAGGGGAAACAGGCACAGAGAGG - Intronic
1134845760 16:17438707-17438729 AAGGGGAAGCAAGCATATGGTGG + Intronic
1135109790 16:19681707-19681729 CAACGGTAACAGCCAAATGGAGG - Intronic
1137627198 16:49916689-49916711 CTGGGGAAACAGGCTAGTGGGGG - Intergenic
1138548755 16:57735789-57735811 CAGGGGATGGAGGCAAGTGGGGG + Exonic
1139131635 16:64153386-64153408 CATCGGAAATAGGCAAAAGGTGG + Intergenic
1142036049 16:87862644-87862666 CAGGAGATACAGGCACGTGGAGG + Intronic
1144767263 17:17739637-17739659 CAGGGGAAGCAGGCAGGTGCTGG - Intronic
1145259004 17:21343714-21343736 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1145317617 17:21744290-21744312 CTGGGGAAACAGGCACAGAGAGG - Intergenic
1147608755 17:41789051-41789073 TTGAGGAAACAGGCAAAGGGCGG - Intergenic
1147916180 17:43888302-43888324 CTGGGGAAACAGACAACTGATGG + Intronic
1148568814 17:48650200-48650222 CTGGGGAAAGAGGGGAATGGGGG - Intergenic
1149516157 17:57282585-57282607 GAGAGGAAGCAGGGAAATGGGGG - Intronic
1150640726 17:66947886-66947908 CCAGGGAAAGAGGCAGATGGAGG - Intergenic
1152541818 17:80980368-80980390 CAAGGGACACAGGGGAATGGAGG - Intergenic
1152704520 17:81835913-81835935 CAGGGGAGCCAGGCACGTGGAGG - Intergenic
1156002641 18:32402610-32402632 CAGGGGGAACAGGCTAAGGGTGG - Intronic
1156734853 18:40243465-40243487 CTGGGGAAACAGGGAGATGTTGG - Intergenic
1156959303 18:43004037-43004059 CAGGTGAAACAGCCACCTGGCGG - Intronic
1157016672 18:43723190-43723212 CAGGGAAATCAGGCAAAAGAAGG + Intergenic
1157168042 18:45376397-45376419 CAGGGGAATGAGGGAAATGATGG + Intronic
1158552647 18:58449653-58449675 CAGTGGACACAGGCATGTGGTGG - Intergenic
1159424552 18:68268431-68268453 CAGGGGAAAAAAGAAAATGAAGG + Intergenic
1160832151 19:1109092-1109114 AGGGGGAAACCGGCAGATGGCGG - Intronic
1161470703 19:4455633-4455655 CAGGGGAGACAGGCCACGGGAGG - Intronic
1162540699 19:11294237-11294259 AAGGGAAAGCAGGAAAATGGGGG - Intergenic
1162668035 19:12231576-12231598 CAGTGGAAATGGGGAAATGGAGG + Intronic
1163167231 19:15506791-15506813 CAGGGGACAGAGACAAAGGGTGG - Intergenic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1164825866 19:31284508-31284530 GAGGGGAACCGGGCAAATGGTGG - Intronic
1164861484 19:31565462-31565484 CAGTGGAAACAGGAAATGGGTGG + Intergenic
1168063289 19:53906157-53906179 CAGGGGAAACAGGCAAATGGAGG - Intronic
1168309086 19:55451805-55451827 CGGGGGAAGGAGGGAAATGGAGG - Intergenic
925496083 2:4450881-4450903 AAGGGCAAAGAGGCAAAAGGGGG - Intergenic
926774504 2:16408679-16408701 CAAGGGAAACTGGAAAATGTAGG + Intergenic
927042657 2:19245400-19245422 CAGGTTAGACAAGCAAATGGTGG + Intergenic
928859076 2:35834028-35834050 CAGGGAAAACAGGAAAATCATGG + Intergenic
929815483 2:45227822-45227844 CAGGGGAAAAGAGAAAATGGAGG + Intergenic
931252809 2:60549398-60549420 CAGGGTAAAGAAGCAAACGGAGG + Intronic
931784987 2:65610562-65610584 CAGGGAAGACAGACAAATGGAGG - Intergenic
934495035 2:94789187-94789209 CAGTGGGAACTGGTAAATGGAGG - Intergenic
936154151 2:110037316-110037338 CAAGGGAAACACGCAACTGCAGG - Intergenic
938793884 2:134702258-134702280 CAGGGGAAAGAAGCACCTGGAGG + Intronic
938794683 2:134707590-134707612 TAGGGGAAACAGGCAAGTTTAGG + Intronic
938806823 2:134813837-134813859 CATGTAAAACAGGCAAATAGTGG + Intergenic
939764474 2:146229170-146229192 CAAGTGAAACTGGCATATGGGGG - Intergenic
940772713 2:157856284-157856306 CAGGGGAAACTGGAAATAGGTGG - Intronic
940893798 2:159061342-159061364 CAGGGGAGAAAGGCAAGGGGAGG - Intronic
942058345 2:172205809-172205831 CAGGGGAAACAGAGAAGTGGAGG + Intergenic
942385776 2:175441255-175441277 CTGGGGAAACAGCCACAAGGAGG - Intergenic
943659944 2:190548506-190548528 CAGGTGAAACAGTGAAATGGAGG - Intergenic
946413229 2:219526079-219526101 CAGGGTTAACAGGCAATTAGCGG - Intronic
946798597 2:223384669-223384691 CACTGGAAACAGCCAAATGCAGG + Intergenic
1168897395 20:1333207-1333229 CATGGGAGACTGGGAAATGGAGG + Intronic
1169707020 20:8517448-8517470 CAGGGGAGAGAGGCCAGTGGTGG + Intronic
1170372056 20:15659829-15659851 CAGGGGAAACAGACATATGAGGG + Intronic
1171211756 20:23322192-23322214 CAGGGGAGGCTGGCAAATGCAGG + Intergenic
1172022989 20:31927747-31927769 CATGGGAAAGATGGAAATGGGGG + Intronic
1172174064 20:32961640-32961662 CAGGGCAACCAGGCCCATGGCGG + Intergenic
1172498978 20:35411660-35411682 GAGGGGAAGCAGGTACATGGGGG + Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173174862 20:40756810-40756832 TATGGGGGACAGGCAAATGGAGG - Intergenic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1175358338 20:58387190-58387212 GAGGGGGAACAGGCAAACAGTGG + Intergenic
1175904353 20:62372250-62372272 CAGGGGAAACAGGCGGAATGGGG + Intergenic
1177518476 21:22186390-22186412 CAGAGGAAAGAGGTAAATGGAGG - Intergenic
1177651836 21:23968188-23968210 CGGGGGAACCAGGCAACTGAAGG - Intergenic
1179581650 21:42348098-42348120 CAGGGAAACCAGGCAGATGGTGG - Intronic
1179828346 21:43981089-43981111 GAGGGGAGACAGGAGAATGGTGG - Exonic
1179921053 21:44507834-44507856 CAGGAGAAACAGGCACGGGGCGG - Intronic
1181844368 22:25694751-25694773 CAGGGGAGGCAGGGAAAGGGAGG - Intronic
1182540420 22:31037540-31037562 CAGGGGAAACAGGCTCAGAGAGG - Intergenic
1183517639 22:38276367-38276389 CAGGGGACAGAGGCAGGTGGTGG + Intergenic
1184436956 22:44484941-44484963 CTGGGGCAGCAGGCAACTGGAGG + Intergenic
1184455693 22:44608464-44608486 CCCGGGAAACAGGCGGATGGAGG - Intergenic
1184640802 22:45868986-45869008 CAGGGGAGACAGGCCACTGCAGG - Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
950167799 3:10814875-10814897 GAGGGGAAACGGGAAGATGGTGG + Intergenic
950366280 3:12486715-12486737 CAGGGAAAAGTGGGAAATGGGGG - Intronic
950944168 3:16927707-16927729 CGGGGGAAACAGGCAGGTAGGGG - Intronic
950946868 3:16958361-16958383 ATGAGGAAACATGCAAATGGTGG - Intronic
950964068 3:17134074-17134096 CAGGGAAAAGAAGCAGATGGAGG + Intergenic
953229846 3:41055062-41055084 CTGTGGAAACAGGCAGATTGAGG + Intergenic
954873908 3:53788263-53788285 CTGGGGAAAGAGGCATATGCGGG + Intronic
955051264 3:55413491-55413513 TATGGGTAAGAGGCAAATGGAGG + Intergenic
955215815 3:56984229-56984251 CAGGGGAAAATGGCAGATTGTGG - Intronic
955666641 3:61356024-61356046 GAGTGGAAACAGGCAGATGATGG + Intergenic
956801686 3:72765302-72765324 CTGAGGAGACAGGCAAGTGGTGG - Intronic
957021210 3:75129318-75129340 CAGGGCAGACAGCCAAAAGGGGG + Intergenic
957240384 3:77653412-77653434 AAGAGGGAACAGACAAATGGTGG + Intergenic
959092136 3:101914696-101914718 TAGGAGAAACAGGAAAATGTTGG - Intergenic
959716449 3:109438802-109438824 CTGGGGACACAGGCTAGTGGAGG - Intergenic
959953595 3:112210531-112210553 CAGGGCAAAAAGGCAAAATGGGG + Intronic
961690379 3:128665134-128665156 CAGGAGAAACCGGGAGATGGAGG + Intronic
962289011 3:134114733-134114755 CAGGGGAAATGGGGAAATGTTGG + Intronic
962330273 3:134472081-134472103 TGGGGGGAACAGGCAAAGGGTGG - Intergenic
962581773 3:136804450-136804472 CAGGGGAAACAGGGATATTCTGG - Intergenic
963277486 3:143347403-143347425 CAAAGGAAACAGATAAATGGAGG + Intronic
963577292 3:147076988-147077010 CAGGGCAATCAGGCAAGAGGAGG - Intergenic
963926933 3:150960745-150960767 CACAGGAGACAGGCAGATGGAGG + Intronic
965057275 3:163737714-163737736 CAGTGGAAACAGAGAACTGGAGG + Intergenic
965835159 3:172843099-172843121 CAGGGGAAACTGAGACATGGCGG - Intergenic
967905691 3:194497839-194497861 CATCTGAAACAGGCACATGGAGG - Exonic
967907533 3:194514071-194514093 AAGGGGACACAGCCAACTGGTGG + Intergenic
969048886 4:4358555-4358577 CAGGGGGCACAGGCAGCTGGCGG - Intronic
969783631 4:9433533-9433555 CAGGGTCCACAGGCAGATGGCGG - Intergenic
970218448 4:13783421-13783443 CAGGTGAAACAGTGAAAGGGAGG + Intergenic
970550730 4:17178405-17178427 CAGAGTGAACAGGGAAATGGAGG + Intergenic
972255482 4:37350677-37350699 CAGGGCAATCAGGCAAAAGAAGG - Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
975554285 4:75645456-75645478 AAGAGGAACCGGGCAAATGGAGG - Exonic
975852441 4:78586304-78586326 CAGGACAAGCAGGCAAATGAAGG + Exonic
976469774 4:85414787-85414809 AAGACAAAACAGGCAAATGGTGG + Intergenic
977038585 4:91984754-91984776 CAGTGGAACAAGGCAACTGGCGG + Intergenic
978338737 4:107698561-107698583 ATGGGGAGACAGGCAAATGAAGG + Intronic
978845465 4:113268244-113268266 CAGGGCAATCAGGCAAGGGGAGG - Intronic
979591012 4:122480298-122480320 CAGGGAAGAAAGGCTAATGGTGG + Intergenic
980994337 4:139766081-139766103 GAGGAGAAACAGGGAAAAGGGGG - Intronic
982920538 4:161268202-161268224 CAGGGAAGACAGGAAAATGTGGG - Intergenic
985360693 4:189172456-189172478 CATGAGAAACAGGAAAATGGTGG + Intergenic
985614279 5:910281-910303 CCGGGGAGACAGGAGAATGGAGG - Intronic
986809906 5:11346071-11346093 CAGGGGAAACTGGGGACTGGAGG - Intronic
987211805 5:15691445-15691467 CAGGAGAAAGAGCCAAATGACGG - Intronic
988544916 5:32146445-32146467 AAAGGGAATCAGGCAGATGGAGG - Intronic
989164987 5:38425042-38425064 AAGGGGACAGAGGCAAATGTAGG - Exonic
991973974 5:72168024-72168046 CAGGGGCAAGAGCCAAGTGGAGG - Intronic
992167379 5:74068005-74068027 CAGGAAAAACAGGAAAACGGGGG - Intergenic
992624813 5:78627357-78627379 CAGGGGAGACAGGGAAAGTGAGG - Intronic
992975136 5:82108878-82108900 GATGGGAAACAGGCATAGGGGGG + Intronic
993494356 5:88590740-88590762 CAGGGCAATCAGGCAAAAGATGG + Intergenic
993621813 5:90177483-90177505 CAGGGTAATCAGGCAAGTGAAGG + Intergenic
993732609 5:91440385-91440407 CAGGGGAAATAGGGAAATGGGGG + Intergenic
994040042 5:95248516-95248538 AAGAGGACACAAGCAAATGGAGG + Intronic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
997933181 5:138088803-138088825 AAGGTGAGACAGGGAAATGGAGG - Intronic
998400409 5:141845878-141845900 TAGGTGAAAAAGGCAGATGGGGG - Intergenic
998457887 5:142287755-142287777 CATGGGAAGGAGGCAAATCGTGG + Intergenic
999009365 5:148018240-148018262 AAGTGGAAACAGTCAAATGAGGG - Intergenic
999129732 5:149273285-149273307 CACAGCAAACAGGCAGATGGGGG - Intronic
999136789 5:149325819-149325841 AAGGGCAAAGAGGCAAAAGGGGG + Intronic
999370413 5:151051883-151051905 CAGGGGAGAGAGGCAAGTGCTGG + Intronic
999523055 5:152372526-152372548 CTGGGTAAAAAGGCAAATGTAGG - Intergenic
999641231 5:153675170-153675192 CAAGGGAAGCTGGAAAATGGTGG + Intronic
1002310860 5:178312914-178312936 CAGGCGCAACAGCCAAAAGGTGG + Intronic
1004179379 6:13367734-13367756 CTGGAGAAACAGCCAACTGGAGG + Intronic
1005809162 6:29503097-29503119 CAAGAGAAACAGGCAGATGCTGG - Intergenic
1006767331 6:36519406-36519428 CAGGGGAGACAGGCAGATGAAGG - Intronic
1007325636 6:41057411-41057433 CAGGGAAAACAGGCAAGTTCAGG + Intronic
1007749567 6:44063661-44063683 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1008467410 6:51846305-51846327 CAAGTGAAAGAGGCAAAGGGTGG + Intronic
1010424429 6:75711601-75711623 CTGGGGAAACTGGCAAATGGAGG - Intronic
1010854234 6:80817389-80817411 TAGGGGAAACTGGGAAATGATGG - Intergenic
1014337730 6:120158909-120158931 CAGAGGAAACAGACCAATGAAGG - Intergenic
1015437670 6:133208391-133208413 CAGGGGAAACAGGGAGAGAGGGG - Intergenic
1016372195 6:143386709-143386731 CAGGGACAGCAGCCAAATGGTGG + Intergenic
1016887712 6:148973062-148973084 AAGGGGAAGAAGGCAAATGCAGG - Intronic
1017228167 6:152043705-152043727 CAGAGGAAACAGGCAACAGAGGG - Intronic
1017295007 6:152783339-152783361 CAGGAGAGCCAGGCAGATGGTGG - Intergenic
1018094944 6:160377183-160377205 CAGTTGAAACAGGGAAATGTGGG + Intronic
1018197594 6:161368665-161368687 CAGGGGAAGCAGGCAAGTGGAGG - Intronic
1018360350 6:163061498-163061520 CAGAAGAAGCAGGCAAAGGGAGG + Intronic
1018951892 6:168384648-168384670 CAGGGGAGTCAGGCCTATGGGGG + Intergenic
1019902267 7:4030130-4030152 CAGGGGAAGCAGGAAAATTCAGG + Intronic
1023303374 7:38797763-38797785 CAGGGGAAACAGGTTAACAGGGG + Intronic
1023560094 7:41464950-41464972 TAGGGGAAATGGGGAAATGGCGG - Intergenic
1024292614 7:47815867-47815889 CAGGAAAGACAGGCAAGTGGTGG + Intronic
1026683591 7:72489209-72489231 CAGGGGAAACAGGCAGAACAAGG + Intergenic
1026692571 7:72562134-72562156 CAGGGAACAAAGGAAAATGGGGG - Intronic
1026798723 7:73383488-73383510 AAGGGAGAAGAGGCAAATGGTGG + Intergenic
1026895030 7:74005385-74005407 GAGGGGAATAAGGGAAATGGGGG - Intergenic
1027979976 7:85205635-85205657 TAGGGGAAAGAGGCAAAAGAAGG - Intergenic
1028284114 7:88973377-88973399 CAGGGAAAACAGGCCAATCCTGG + Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1030136445 7:106255844-106255866 AAAGGGAAACAGGTAGATGGAGG + Intronic
1030371295 7:108702191-108702213 CTGGGAAAATAGGCAAAAGGAGG - Intergenic
1030623812 7:111821347-111821369 AAGGGGAAGCAGGCAAATGTGGG + Intronic
1030928528 7:115489507-115489529 CACCAGAAACAGGCAAATGCAGG - Intergenic
1031424426 7:121588057-121588079 CATGAGAAACAGGTAAATGTGGG - Intergenic
1033279017 7:139992636-139992658 CAGAGGCCACAGGCAGATGGTGG - Intronic
1034748182 7:153542747-153542769 AAGGGGAAACAGGGAGATGATGG + Intergenic
1035073637 7:156162764-156162786 CGGGGGACACGGGCAAAGGGCGG - Intergenic
1035236779 7:157502470-157502492 GAGGGGAAACAGGGAAACAGAGG + Intergenic
1035885563 8:3287796-3287818 CAGGGCAATCAGGCAGCTGGAGG - Intronic
1036221037 8:6921848-6921870 CTGGGGAAAGAAGCAATTGGGGG + Intergenic
1036835405 8:12060546-12060568 CAGGGTCCACAGGCAGATGGCGG + Intergenic
1036857247 8:12307109-12307131 CAGGGTCCACAGGCAGATGGCGG + Intergenic
1037134966 8:15449581-15449603 TAGGGGAAAAAGCCTAATGGAGG + Intronic
1037791440 8:21946031-21946053 TAGCAGAAACAGGAAAATGGAGG + Intronic
1038388368 8:27171564-27171586 CCGGGGGAAAGGGCAAATGGGGG - Intergenic
1039413236 8:37373205-37373227 AAGGGGAAGCAGGCACAAGGCGG + Intergenic
1039488728 8:37931628-37931650 CAAGGGAAAAAGGCACAGGGTGG + Intergenic
1040442013 8:47453209-47453231 AAGAGGATACAGACAAATGGAGG + Intronic
1040561035 8:48523744-48523766 CAGGGGCAACAGGAAAACGCAGG - Intergenic
1041213441 8:55576071-55576093 AAGAGGAAACAAACAAATGGAGG + Intergenic
1044695521 8:94918713-94918735 CAGGGGAAGAGGGCAAAAGGAGG - Intronic
1045970975 8:108079879-108079901 AAGGGGAAAAAGGGAAATGTTGG + Intronic
1046551784 8:115727393-115727415 AAGGGCAAAGAGGCAAAAGGGGG + Intronic
1047148661 8:122235491-122235513 CAGGGAAAAAAGGCAAAATGTGG - Intergenic
1049151359 8:141037463-141037485 CAGGGGAAACGGGGAGAAGGGGG - Intergenic
1049379855 8:142306575-142306597 CAGGGGAGACAGGCAAGAGACGG + Intronic
1049713847 8:144080239-144080261 CAGGTGCTACAGGCAGATGGTGG + Exonic
1050164813 9:2753979-2754001 CAGGGCAATCAGGCAAGAGGAGG + Intronic
1051336687 9:16071907-16071929 GAGGGGAAACAGGGATTTGGGGG - Intergenic
1052028654 9:23603734-23603756 CAGCGGAATGAGGCTAATGGAGG - Intergenic
1052889206 9:33681661-33681683 CATGGGAAATAGGGAAATGTTGG + Intergenic
1053167038 9:35852399-35852421 CAGGGGAAACTGGGACATAGTGG + Intronic
1053662086 9:40291167-40291189 CAGTGGGAACTGGTAAATGGAGG + Intronic
1054374213 9:64437407-64437429 CAGTGGGAACTGGTAAATGGAGG + Intergenic
1054522524 9:66085117-66085139 CAGTGGGAACTGGTAAATGGAGG - Intergenic
1054964300 9:71004504-71004526 AAGCTGGAACAGGCAAATGGGGG + Intronic
1055524023 9:77111719-77111741 CAGGGGAAAGAGGAAAATGGAGG - Intergenic
1055594139 9:77848487-77848509 CAGGGAAAACAGGCCAATTTGGG - Intronic
1055863705 9:80786767-80786789 CAAAGGAAACAGGGAAAAGGCGG + Intergenic
1057811040 9:98256691-98256713 AAGGGGAAACAGGTAAAATGAGG - Intergenic
1057842293 9:98495789-98495811 CAGGGGAAACAGGAACAAAGGGG - Intronic
1058688234 9:107497114-107497136 CAGGGGAAGCAGGCAAAACTTGG - Intergenic
1058771410 9:108236370-108236392 AGGGGGAAACAGGGAGATGGTGG + Intergenic
1059147273 9:111911511-111911533 TAATGGAAACAGGCAGATGGGGG + Intronic
1059267824 9:113052176-113052198 CAGGTGAAGCATGCAAATGAAGG - Intronic
1059305512 9:113350296-113350318 CAGGGGGAAGAGGCGAAAGGAGG - Intronic
1059491170 9:114668420-114668442 CAGCGCACACAGGCAAGTGGGGG + Intergenic
1061047900 9:128177211-128177233 AAGAGGAAACAGGCACAGGGTGG + Intronic
1061400646 9:130366355-130366377 CAGGGGTCACAGACTAATGGAGG - Intronic
1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG + Intergenic
1062240384 9:135534471-135534493 CAGGGTAAACAGGCTCAGGGCGG - Intergenic
1062374644 9:136256461-136256483 GAGGGGAATCTGGCAAGTGGGGG - Intergenic
1187088976 X:16073980-16074002 CTGGGGAAATAGGTACATGGAGG - Intergenic
1187572268 X:20516982-20517004 CATGTGAAACAAGCAAAAGGTGG + Intergenic
1188443769 X:30235857-30235879 CAGGTGATACAGGCACCTGGAGG - Exonic
1189617444 X:42798349-42798371 CAAGTGACACAGACAAATGGAGG + Intergenic
1189651972 X:43199793-43199815 CAGGGCAATCAGGCAAAAGAAGG - Intergenic
1193549742 X:82877104-82877126 CAGAGCAATCAGGCAAGTGGAGG + Intergenic
1193696036 X:84708474-84708496 CAGCAGAAAGAGTCAAATGGTGG + Intergenic
1195830205 X:109049078-109049100 CATGGGGAACAGGCAAATTATGG - Intergenic
1196417942 X:115492956-115492978 AAGGGGAAACAGGAATTTGGGGG - Intergenic
1196566914 X:117217936-117217958 CAGGGGTAAAAGGAAAATAGGGG + Intergenic
1196891453 X:120294521-120294543 AAGGGAAAACTGGCAAATGGTGG - Intronic
1197597075 X:128478255-128478277 CAGGGGAAATACGAAAATTGTGG - Intergenic
1198293787 X:135264174-135264196 AAGGGGAAGCAAGCACATGGTGG + Intronic
1198506914 X:137310078-137310100 CAGGTGAAACAGGCTCAGGGAGG - Intergenic
1200133478 X:153863700-153863722 TTGGGGCAACAGGCAAGTGGTGG - Intronic
1200179635 X:154142568-154142590 CAGGGGAGGGAGGGAAATGGAGG - Intergenic
1201256078 Y:12109441-12109463 CATGGGCAACATGCAAATGAAGG + Intergenic
1201376943 Y:13332739-13332761 CAGGGGAATCAGGCAAGAGAAGG + Intronic