ID: 1168063665

View in Genome Browser
Species Human (GRCh38)
Location 19:53907853-53907875
Sequence TATCACAGAGGGCACCAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168063662_1168063665 5 Left 1168063662 19:53907825-53907847 CCAGACAGACAGAGACAGGGAGA 0: 1
1: 2
2: 8
3: 136
4: 1033
Right 1168063665 19:53907853-53907875 TATCACAGAGGGCACCAACGTGG No data
1168063661_1168063665 6 Left 1168063661 19:53907824-53907846 CCCAGACAGACAGAGACAGGGAG 0: 1
1: 4
2: 8
3: 124
4: 844
Right 1168063665 19:53907853-53907875 TATCACAGAGGGCACCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168063665 Original CRISPR TATCACAGAGGGCACCAACG TGG Intergenic
No off target data available for this crispr