ID: 1168064405

View in Genome Browser
Species Human (GRCh38)
Location 19:53910753-53910775
Sequence GTTCCTAAGTGGAATTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168064396_1168064405 20 Left 1168064396 19:53910710-53910732 CCTTGAGATCTGGGTTGAGGAGC 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1168064405 19:53910753-53910775 GTTCCTAAGTGGAATTGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 112
1168064400_1168064405 -5 Left 1168064400 19:53910735-53910757 CCTCGCTGGAATTTCTAGGTTCC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1168064405 19:53910753-53910775 GTTCCTAAGTGGAATTGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 112
1168064399_1168064405 -4 Left 1168064399 19:53910734-53910756 CCCTCGCTGGAATTTCTAGGTTC 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1168064405 19:53910753-53910775 GTTCCTAAGTGGAATTGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168064405 Original CRISPR GTTCCTAAGTGGAATTGGGG AGG Intronic
900749866 1:4388686-4388708 GTTAGGAAGTGGAATGGGGGAGG + Intergenic
901383288 1:8889483-8889505 CTTCCTACGGGGACTTGGGGAGG - Intergenic
903110585 1:21129724-21129746 CTTCCTCACTGGAATTGGGGTGG - Intronic
906449879 1:45936394-45936416 CTTCCTATGTGGAATAGGAGTGG + Intronic
907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG + Intronic
910879319 1:91908120-91908142 GTTTCAAAGGGGCATTGGGGTGG + Intergenic
912144205 1:106772504-106772526 TATCTTAAGTGGAATTGGAGAGG - Intergenic
917591024 1:176477171-176477193 GATCCTGAGAGGAAGTGGGGTGG - Intronic
918302928 1:183220355-183220377 ATACCTAAGTGGTCTTGGGGAGG + Intronic
918532348 1:185537548-185537570 GTGCCCAGGTGGAATTGTGGGGG + Intergenic
921883210 1:220276998-220277020 GTTCCAAATTGGGATTGGAGAGG + Intergenic
924248520 1:242108178-242108200 GTTCCTAACTGGAATTCGATTGG - Intronic
1065249892 10:23800249-23800271 TTTCCTCAGTGGATTTGAGGGGG + Intronic
1065806094 10:29394845-29394867 GTTCCTAAGTGGAAAGGGGCAGG + Intergenic
1069212496 10:65779406-65779428 GTTCCTAAGTGGAAAGGGGTGGG + Intergenic
1071080469 10:81804085-81804107 CTTCCTCCATGGAATTGGGGTGG - Intergenic
1076135517 10:128043118-128043140 GTTTTTCCGTGGAATTGGGGTGG + Intronic
1076866316 10:133168047-133168069 GTTCCAAAGTGGAAGAGGGAAGG - Intronic
1077083015 11:733848-733870 GTTCCTTATTGAAATTGGAGGGG + Intergenic
1080110335 11:28559643-28559665 GTCCCTAAATGAAAATGGGGTGG - Intergenic
1088174883 11:107041091-107041113 GTTCCTAAGTGGAAATGTTGTGG - Intergenic
1089375697 11:117993222-117993244 GTCACTAAATGGAGTTGGGGTGG - Exonic
1091131281 11:133149102-133149124 GCTGCTAAGTAGAATTGAGGTGG - Intronic
1101235623 12:102786720-102786742 GGTCCTAAGGGGAATTTGGGTGG - Intergenic
1102535307 12:113576575-113576597 GTGCTTAAGTGGATTTGGAGAGG + Intergenic
1106414813 13:29537615-29537637 GTTCCTAATGGGAAATGGTGAGG + Intronic
1106935725 13:34716853-34716875 GTACCTATGTGGAATAGGAGTGG + Intergenic
1107194826 13:37637813-37637835 TTTCCTTATTGGAATTGGGAAGG + Intronic
1114514456 14:23288887-23288909 GTTACTAAGTGAAATGAGGGAGG - Intronic
1115388994 14:32832582-32832604 TTTTCTAAGGGTAATTGGGGAGG - Exonic
1122705343 14:103617324-103617346 CTTCCTGAGTGGAATACGGGCGG + Intronic
1126954688 15:53919443-53919465 CTTCCTAATTGGAATCAGGGAGG + Intergenic
1127846751 15:62877150-62877172 ATTCTGAAGTGGACTTGGGGTGG + Intergenic
1128835663 15:70807328-70807350 GTTTCTATGTGGGATGGGGGTGG + Intergenic
1130411447 15:83652250-83652272 GTTCCTAAGTGGAAGAAGGCTGG + Intergenic
1131552950 15:93373491-93373513 GTTCCTAAGTGGAAGAGGAAAGG - Intergenic
1132305322 15:100807777-100807799 GTTCCTGAGTGGAAGGGGGTAGG + Intergenic
1138015982 16:53429175-53429197 ATCCCTAAGAGCAATTGGGGAGG - Intergenic
1143556957 17:7667992-7668014 GTTCCCAAGGGGAACAGGGGTGG - Intronic
1143598606 17:7929967-7929989 TTTTCTGAGCGGAATTGGGGAGG + Intronic
1147383587 17:40069679-40069701 ATTCCTGAGGGGAATTGGGCAGG + Intronic
1148669984 17:49403129-49403151 GTTCCTAGAAGGATTTGGGGTGG + Intronic
1149168927 17:53786493-53786515 TCTCCTAGGTGGATTTGGGGTGG - Intergenic
1152088262 17:78233046-78233068 CTTCCTCAGTGCAACTGGGGAGG + Intronic
1152799929 17:82326128-82326150 GTTCCAAAGTGTAACTGGGCTGG - Intronic
1157605990 18:48926289-48926311 GTTCCTAAATGGAATCTTGGGGG - Intronic
1163142790 19:15361819-15361841 ATTCCTAGGTGGGATTGGAGAGG + Exonic
1165792631 19:38501018-38501040 GTCCCTCTGTGGAAGTGGGGAGG - Intronic
1166225014 19:41389647-41389669 CTTGCTAAGTGGGATTGAGGTGG + Intronic
1168064405 19:53910753-53910775 GTTCCTAAGTGGAATTGGGGAGG + Intronic
929511068 2:42566586-42566608 GTTCCTAAGGGGACATAGGGAGG + Intronic
929734750 2:44535850-44535872 GTTCCTATGTTGAATAGGAGTGG - Intronic
930058949 2:47272750-47272772 GCTCCTAAGTGCCCTTGGGGAGG - Intergenic
930239293 2:48919361-48919383 GTTCCTAATTGGAAGCGGGTGGG + Intergenic
930978687 2:57495687-57495709 GTTCCTAAGTGGAATAAGTTCGG - Intergenic
932810032 2:74817500-74817522 CTTGCTAAGGGGAAGTGGGGCGG - Intergenic
941170068 2:162125454-162125476 GGTCCTAAGAGGACTTTGGGAGG - Intergenic
942161957 2:173198657-173198679 GCTCCTCACTGGAATTGGCGAGG + Intronic
947127666 2:226888194-226888216 ATTCCTCAGTGTAATTAGGGAGG - Intronic
947716007 2:232339159-232339181 CTTCCTAACAGGAACTGGGGAGG - Intronic
947735030 2:232449900-232449922 CTTCCTAACAGGAACTGGGGAGG - Intergenic
1169874710 20:10284283-10284305 CTTCATCAGTGAAATTGGGGAGG - Intronic
1172464080 20:35142563-35142585 GGTCTTAAGTGGAATTAGTGAGG - Intronic
1175125727 20:56750314-56750336 TGTGCTAAGTGTAATTGGGGTGG + Intergenic
1175731596 20:61357942-61357964 GTTCCTAAGTGTATTTGGCAGGG + Intronic
1176607114 21:8842619-8842641 GTTCCTAATAGCAAGTGGGGAGG - Intergenic
949131059 3:501789-501811 CTTGCTAAGTGATATTGGGGTGG + Intergenic
949879125 3:8648086-8648108 CTTCCTATGTGGTATTTGGGGGG - Intronic
951660253 3:25055634-25055656 GTTATTAGGAGGAATTGGGGAGG + Intergenic
955483598 3:59413975-59413997 GTTCCTAAGTGGATCTGTGCTGG - Intergenic
956333423 3:68136658-68136680 GTTCCTAAATGGAAAAAGGGAGG + Intronic
957171701 3:76745567-76745589 GATTCTAAGTGGAACTGGGTGGG - Intronic
960056578 3:113280108-113280130 CTTCATCAGTGGAATTTGGGAGG + Intronic
960224365 3:115152026-115152048 TTACATAAGTGGATTTGGGGAGG + Intergenic
962240733 3:133748717-133748739 CTTCAAAAGTGGAAATGGGGAGG + Intronic
963893372 3:150660190-150660212 GTCCAGAAGTGGAACTGGGGAGG + Intronic
964497172 3:157303780-157303802 GTTTCTAAGTGGCAATGGTGAGG - Intronic
972977671 4:44657889-44657911 GTGGCTTAGTGGGATTGGGGTGG + Intronic
973371006 4:49248595-49248617 GTTCCTAACAGCAAGTGGGGAGG + Intergenic
973390020 4:49546860-49546882 GTTCCTAATAGCAAGTGGGGAGG - Intergenic
975008495 4:69320826-69320848 GTTCCTAGGTGGAAATGGGTGGG + Intronic
975325085 4:73050146-73050168 GTTCTTAATTGGGATTGTGGAGG + Intergenic
979685293 4:123505430-123505452 GTTCCAAAGTCCAATTGTGGCGG - Intergenic
981157504 4:141456826-141456848 GTTTCTAAGAGGAGTTGGGCAGG + Intergenic
993435346 5:87886174-87886196 GTGCCTAAGTAGAATTGTGAAGG - Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1006150284 6:31983405-31983427 GAGCCTAACAGGAATTGGGGTGG - Intronic
1006156585 6:32016143-32016165 GAGCCTAACAGGAATTGGGGTGG - Intronic
1006467139 6:34202626-34202648 ATTCCTGAGTGGAAGTGGGTGGG - Intergenic
1006987856 6:38188677-38188699 CTTCCAAAGAGGAATTTGGGAGG - Intronic
1008586719 6:52957452-52957474 GTTCCTGACTGGGATTGGGAAGG - Intergenic
1010109397 6:72207793-72207815 TTTTCTCAGTGGAATTTGGGGGG - Intronic
1010846863 6:80720175-80720197 GTTCCTAGGTGGAAAAGGGCAGG + Intergenic
1012716500 6:102679558-102679580 GTTCGTAAGTGGTCTTGGGAAGG + Intergenic
1013811275 6:114047630-114047652 CTTCCTAAATGGATTTGAGGTGG - Intergenic
1018702837 6:166440951-166440973 GCTCCTCAGTGGAATTGGTTGGG - Intronic
1021291279 7:18848189-18848211 TTTCCTAAGCGGAATTAAGGAGG + Intronic
1021770804 7:23998976-23998998 TTTCCTTAATGGAATTTGGGTGG - Intergenic
1022050120 7:26658834-26658856 GTTCCTACTTGGAGTTGGTGGGG - Intergenic
1023706050 7:42942783-42942805 TTTCAGAAGTGGAATTGGTGAGG + Intronic
1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG + Intergenic
1029593288 7:101521454-101521476 GTGCCTAAGTGCCCTTGGGGTGG + Intronic
1031411465 7:121444672-121444694 ATTCCAAAGTGGATTTTGGGGGG + Intergenic
1034111209 7:148539482-148539504 GTTCCTCAGTGTAATTGCAGAGG + Intergenic
1034915321 7:155033995-155034017 GATTCTAAGTGGATTTGGGCAGG + Intergenic
1039387543 8:37149329-37149351 ATTCCAAAGTGGAGGTGGGGTGG + Intergenic
1039636746 8:39175686-39175708 GTTCATAAAATGAATTGGGGAGG + Intronic
1043316718 8:78931952-78931974 TTTGCTAAGGGAAATTGGGGAGG + Intergenic
1044517585 8:93157054-93157076 GTTCCAAATAGGAAATGGGGTGG + Intronic
1047217068 8:122884812-122884834 GTTCTTAAGTAGAATTGTGAAGG - Intronic
1051098135 9:13490123-13490145 GTTCCCAATTGGAGTGGGGGTGG - Intergenic
1051377778 9:16421228-16421250 CTTCCTAAGTGCAGTTGGAGAGG - Intronic
1052100649 9:24442033-24442055 GTTACTAAGTTGAATAGGAGTGG - Intergenic
1053455024 9:38227104-38227126 GCTCTTAAGTGGAGTGGGGGAGG + Intergenic
1055550432 9:77427865-77427887 GATCCCTAGTGGAACTGGGGTGG - Intronic
1060966915 9:127716676-127716698 GTCCCTAAGGGGAATGGGGCTGG + Exonic
1061367753 9:130181479-130181501 GCTCCTGGGTGGAATTGGTGAGG - Intronic
1203554427 Un_KI270743v1:193566-193588 GTTCCTAATAGCAAGTGGGGAGG - Intergenic
1199549892 X:149048219-149048241 ATTCCTATGTTGAATTGGAGTGG + Intergenic