ID: 1168064775

View in Genome Browser
Species Human (GRCh38)
Location 19:53912883-53912905
Sequence GCGTGTGGCCTGCTCCTGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168064769_1168064775 5 Left 1168064769 19:53912855-53912877 CCTGACCCTGCTGAGCAGCGTGT 0: 1
1: 0
2: 3
3: 10
4: 140
Right 1168064775 19:53912883-53912905 GCGTGTGGCCTGCTCCTGGTAGG 0: 1
1: 0
2: 2
3: 5
4: 137
1168064772_1168064775 -1 Left 1168064772 19:53912861-53912883 CCTGCTGAGCAGCGTGTTTGGTG 0: 1
1: 0
2: 0
3: 15
4: 77
Right 1168064775 19:53912883-53912905 GCGTGTGGCCTGCTCCTGGTAGG 0: 1
1: 0
2: 2
3: 5
4: 137
1168064768_1168064775 6 Left 1168064768 19:53912854-53912876 CCCTGACCCTGCTGAGCAGCGTG 0: 1
1: 0
2: 5
3: 19
4: 191
Right 1168064775 19:53912883-53912905 GCGTGTGGCCTGCTCCTGGTAGG 0: 1
1: 0
2: 2
3: 5
4: 137
1168064771_1168064775 0 Left 1168064771 19:53912860-53912882 CCCTGCTGAGCAGCGTGTTTGGT 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1168064775 19:53912883-53912905 GCGTGTGGCCTGCTCCTGGTAGG 0: 1
1: 0
2: 2
3: 5
4: 137
1168064767_1168064775 11 Left 1168064767 19:53912849-53912871 CCGCGCCCTGACCCTGCTGAGCA 0: 1
1: 0
2: 3
3: 32
4: 327
Right 1168064775 19:53912883-53912905 GCGTGTGGCCTGCTCCTGGTAGG 0: 1
1: 0
2: 2
3: 5
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168064775 Original CRISPR GCGTGTGGCCTGCTCCTGGT AGG Exonic
901104717 1:6746250-6746272 GCCTTTGGCGTGCTTCTGGTTGG - Intergenic
903011547 1:20334412-20334434 ACGTTTGCCCTGCTACTGGTAGG + Intronic
906293715 1:44636277-44636299 ACGTGGGGACTGCTGCTGGTGGG + Intronic
907989348 1:59564472-59564494 GGGTGTGGCCTGGGCCTGGGGGG + Intronic
911027396 1:93448874-93448896 GCGTGTGGGCTGGGCCTGGCTGG - Intronic
912561434 1:110554543-110554565 GAGGGTGGCCTGCTCTAGGTTGG + Intergenic
916597081 1:166254170-166254192 GCTGGTGGCCTGCTCCTCTTGGG + Intergenic
1063568799 10:7195699-7195721 ACAGGTGGCCTGCCCCTGGTAGG - Intronic
1067096920 10:43307549-43307571 GCGCCTGACCTGCTCCTGGGAGG + Intergenic
1069589493 10:69633000-69633022 GTTCGTGGCCTCCTCCTGGTTGG + Exonic
1071090759 10:81915310-81915332 GCATGTGCTCTGCTCGTGGTTGG + Intronic
1072436190 10:95416436-95416458 GCATGTGGCCTGCTACGGGCTGG - Intronic
1073793745 10:106965326-106965348 GCATGTGGCAGGATCCTGGTTGG - Intronic
1076646989 10:131960616-131960638 GTGTGTGTCCTGCTCCCGGCCGG + Intergenic
1077075987 11:702383-702405 GGGTGTGGCCTGGCCCTGCTGGG + Intronic
1077160028 11:1108442-1108464 GCCTGGGGCCTCCTCCAGGTGGG + Intergenic
1078545045 11:12241113-12241135 GGGTGTGGCCTCCTCCGGCTTGG - Exonic
1084606459 11:70175189-70175211 GCGGAAGGCCTGCTGCTGGTGGG - Intronic
1085690717 11:78661692-78661714 GGGTGTGGATTGCTGCTGGTGGG + Intronic
1088400513 11:109418701-109418723 TCCTGTAGACTGCTCCTGGTTGG + Intergenic
1089013921 11:115151548-115151570 GAGTGTGGTCTGCTCCTGAATGG - Intergenic
1089197776 11:116704951-116704973 TCGTGGGGCATGCTCATGGTGGG - Intergenic
1089515316 11:119028312-119028334 TCTTCTGGGCTGCTCCTGGTTGG - Exonic
1090843242 11:130510720-130510742 GTGTGAGGCCTGCTCCTTCTGGG + Intergenic
1091490145 12:925873-925895 GTGTGTTGCCTACTCCTGCTGGG - Intronic
1091760689 12:3085289-3085311 CCGTGGGGCCTGTTCCTGGTGGG + Intronic
1103337504 12:120200891-120200913 GCGCGTGTCCTGCTCCTCTTAGG - Exonic
1103721342 12:122977113-122977135 GCGGATGTCCTGCTCCTGGCAGG - Intronic
1104916816 12:132269735-132269757 GCGTGGGGCCGGATCCCGGTGGG + Intronic
1105247400 13:18665940-18665962 CCCTGTGACCTGCTCCTGGCCGG - Intergenic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1105658259 13:22464259-22464281 GCGTCTTGACTGCTCCTGGATGG - Intergenic
1105704986 13:22963045-22963067 TCCTGTGCCCAGCTCCTGGTTGG - Intergenic
1105827727 13:24137296-24137318 GCCAGGGGCCTGCTCCTGGCTGG + Intronic
1106419390 13:29572824-29572846 GTGTGTTGGCTGCTTCTGGTTGG - Intronic
1113947297 13:114051386-114051408 GCGTGAGGTCTGCTCCTGACGGG + Intronic
1118430206 14:65711067-65711089 AGGTGGGGCCTGGTCCTGGTGGG - Intronic
1123121488 14:105918954-105918976 GCCTGTGGCCTGGTCGAGGTTGG + Intronic
1124339973 15:28884751-28884773 CAGTGGGGGCTGCTCCTGGTAGG - Intronic
1131049134 15:89334768-89334790 GCGTGTGGCCTCCACCCGGCCGG + Exonic
1132214911 15:100055354-100055376 GCTTGTGGCCTGCTCCAGCCTGG - Intronic
1132693996 16:1194086-1194108 GCCTGTGGTCTGCGCCAGGTGGG + Intronic
1132694193 16:1194769-1194791 GCCTGGGGCCTGCGCCTGGCCGG - Intronic
1132728648 16:1349884-1349906 GCCTGTGGCCAGCACCCGGTAGG - Exonic
1132765436 16:1532100-1532122 GCCTGTGCCCTGCTCCTCGGAGG - Intronic
1140807364 16:78545322-78545344 GATTGTGGCCTGCTCCTCGTGGG + Intronic
1141682053 16:85550582-85550604 GGTTGTGGCCTGGTCCTGGGGGG + Intergenic
1142020876 16:87781584-87781606 GTGTGTGGCCTCCTGCTGCTGGG + Intergenic
1145725513 17:27118291-27118313 GCATGTGGCCTGCTGGTCGTAGG - Intergenic
1146306474 17:31733469-31733491 AAGTGTGGCCTGGTCCTGGCAGG - Intergenic
1148741704 17:49896996-49897018 AGGTGGGGCCTGCTCCTGGAGGG - Intergenic
1152765920 17:82138673-82138695 ACGCGTGGCCTGCCCCGGGTCGG + Intronic
1156327236 18:36085466-36085488 GCTTGAGTCCTGCTCCTGGGAGG - Intergenic
1157257725 18:46153378-46153400 GCCTGTGGCCTCCTCCTTATCGG - Intergenic
1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG + Intergenic
1158832104 18:61290797-61290819 GCTTTTGGCTGGCTCCTGGTAGG + Intergenic
1159939531 18:74396127-74396149 GCGTCTGACATGCTCCAGGTTGG - Intergenic
1160501513 18:79403410-79403432 GCCCGGGGCCTGCTCCTGGGTGG - Intronic
1160950766 19:1666138-1666160 GCATGTGCCCTGCACCTGGCCGG + Intergenic
1162100019 19:8333854-8333876 GCGGCTGCCCTCCTCCTGGTCGG - Intronic
1163267194 19:16228361-16228383 GCCTGGGGCCTGCTCCTAGATGG + Intronic
1165499325 19:36175344-36175366 GAGTGCTTCCTGCTCCTGGTTGG - Intergenic
1168064775 19:53912883-53912905 GCGTGTGGCCTGCTCCTGGTAGG + Exonic
925532950 2:4884248-4884270 GCGCTTGGCGTGCTCCGGGTGGG + Intergenic
929097902 2:38281310-38281332 GCATGTGTCCTGCACATGGTAGG - Intergenic
930627907 2:53719463-53719485 GAGTTTGGCATGTTCCTGGTCGG - Intronic
937091235 2:119207724-119207746 GCCGGTGTCCTGCTCCAGGTAGG + Intergenic
944441584 2:199748944-199748966 GAGTGTGGACTGCACCTTGTGGG - Intergenic
947605478 2:231483056-231483078 GTGTGCGGCCTGCACCTGGCGGG + Intronic
947839309 2:233197548-233197570 GGGTTTGGCCTGTTCCTGGACGG - Intronic
1170716537 20:18836424-18836446 ACGTTTGGGGTGCTCCTGGTAGG + Intergenic
1172658243 20:36549716-36549738 GCGGGTGGCGTGCTCTGGGTGGG - Exonic
1173825810 20:46047103-46047125 GCTGGTGGCCTTCTCCTGGGAGG + Intronic
1175112255 20:56656907-56656929 GCATCTGGCCGGCTGCTGGTGGG + Intergenic
1175445397 20:59016200-59016222 GAGTGTGTCCTTCTCCAGGTGGG - Intergenic
1176294752 21:5065498-5065520 GCATGTGTCTTGCTCCTGGAGGG + Intergenic
1178704007 21:34858082-34858104 CCTGGTGGCCTGCCCCTGGTGGG + Intronic
1179505859 21:41839762-41839784 GGGTGTGTCCTGCTCCTTCTCGG + Exonic
1179862299 21:44196628-44196650 GCATGTGTCTTGCTCCTGGAGGG - Intergenic
1180052465 21:45337650-45337672 TCATGTGGCCTCCTCCTTGTGGG - Intergenic
1180085475 21:45506192-45506214 GCGTGTGAGGGGCTCCTGGTGGG + Intronic
1180868897 22:19135000-19135022 GGCTCTGGCCTGCTCCTGTTCGG - Intronic
1180877418 22:19181089-19181111 GCATGTGGCCTGCTTATGGGGGG + Intronic
1182557766 22:31138280-31138302 GTGTGTGGCGTGGTACTGGTGGG - Exonic
1183840754 22:40498737-40498759 GCCTGTGGCCTGCTCCTGAGAGG - Intronic
1184143149 22:42591561-42591583 GGGTGAGAGCTGCTCCTGGTGGG - Intronic
1184317356 22:43706244-43706266 GCCAGGGGCCTGCTCCTGGGAGG + Intronic
949539006 3:5017836-5017858 GGGTGCGGCCCTCTCCTGGTAGG - Intergenic
950263319 3:11557533-11557555 GCGGGAGGCCAGCTCCTGGCAGG - Exonic
953876992 3:46672079-46672101 GAGTGTGGGGTGCTCCTGGTTGG - Intronic
954401311 3:50321241-50321263 ACGTGGGGCCTGCGCCCGGTCGG + Exonic
954458122 3:50611076-50611098 GGGTTTGGCCTGGTCCTGCTTGG - Intronic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
954866390 3:53733180-53733202 GGGTGTGGCCAGGTCCTGGGAGG + Intronic
959048082 3:101496867-101496889 GTGTTTGGCCTGGGCCTGGTGGG - Intronic
959116416 3:102183823-102183845 GCTGGAGGCCTGCTCCTTGTTGG + Intronic
962824882 3:139091661-139091683 TCGTGTCCCCTGCTCCTGGAGGG + Intronic
964744680 3:160001342-160001364 GCCTCTGACTTGCTCCTGGTAGG - Intergenic
968081181 3:195847803-195847825 GGGTGTGGCCTGGTCCGGCTTGG - Intergenic
968744155 4:2350834-2350856 GGGTGTGCCCTTCTCCTGGCAGG - Intronic
972235789 4:37132598-37132620 GCCACTGGCCTGCTCCTGCTAGG + Intergenic
972632798 4:40856848-40856870 GCGAGTTGCCTGGTCCTGGACGG - Intronic
974853945 4:67436942-67436964 GACTGTGGCCAGCTGCTGGTTGG - Intergenic
980411357 4:132423560-132423582 GCGTGTGCCTGGCTCTTGGTAGG - Intergenic
985691950 5:1318387-1318409 CCGCGTGGCCTTCTCCTCGTAGG + Exonic
986333839 5:6738154-6738176 GCGTGAAGCCTGCCCCTGGCCGG + Intronic
996769736 5:127073510-127073532 GCCTGGGGCCGGCGCCTGGTGGG - Intergenic
997472462 5:134124492-134124514 GAGTCTGGCCTTCTCCTGGGAGG + Intronic
997601195 5:135139762-135139784 GCCTGTGGCATGCTCCTGGGGGG + Intronic
998616257 5:143743884-143743906 GCCTGTGTCCTGGTCCTGGATGG - Intergenic
999174425 5:149621881-149621903 CCGGGCGGCCTCCTCCTGGTAGG - Exonic
1002527429 5:179822568-179822590 GCCTGTGACCTGCTCCTGAGGGG - Intronic
1002966373 6:1970516-1970538 GCCTGCGGCCTGCTCCTGGTCGG - Intronic
1005090938 6:22056613-22056635 GCGTGTGGCGTGCTTCGGGCAGG - Intergenic
1005649450 6:27873274-27873296 GCGTTTGGCGTGCTCCGTGTAGG + Exonic
1012699549 6:102436516-102436538 GTGTGTAGCCTGCTTCTTGTAGG + Intergenic
1013226252 6:108121083-108121105 GGGTTTGACCTGGTCCTGGTGGG + Intronic
1019589098 7:1820484-1820506 GTGTGAGCCCTGCTCCTGGCCGG - Intronic
1024605585 7:51020145-51020167 CCGTGTGTCCTGCTGCTGCTGGG - Intronic
1026632788 7:72052518-72052540 CCGTGTCTCCTGCTCCTGGGTGG + Intronic
1026847123 7:73704526-73704548 GTGTGTGGCCTGTGGCTGGTGGG + Intronic
1026923541 7:74173846-74173868 TCGTGTGGCCAGCTCCTGCCTGG + Intergenic
1028605111 7:92646688-92646710 GCGCCTGGCCAGCACCTGGTAGG + Intronic
1033554538 7:142477208-142477230 TCCTGTGCCCTGCACCTGGTGGG - Intergenic
1036800729 8:11789122-11789144 GCGTGTGGTCTGCTCCAACTGGG + Intergenic
1041418299 8:57638643-57638665 GCGAGAGGCCTGCTCCTCCTTGG + Intergenic
1045111556 8:98942090-98942112 GCGGGTGACCTGCTCTTGGGTGG + Intronic
1046231024 8:111358552-111358574 GAGTGTGCCCTGCTCTTGGGGGG + Intergenic
1049170863 8:141159850-141159872 GCCTTTGGCCATCTCCTGGTGGG + Intronic
1049554664 8:143275906-143275928 GCGTGGAGCCTGCTCCGGCTTGG - Exonic
1052916767 9:33929078-33929100 TCCTTTGGCCCGCTCCTGGTGGG - Intronic
1053367984 9:37537383-37537405 GCGTGGGCCCTGCACTTGGTAGG + Exonic
1056501810 9:87217060-87217082 GCCAGTGGCTTGCTCCTGGCTGG + Intergenic
1059254304 9:112914733-112914755 GCTTGTGGGTTGCTCCTGGCTGG - Intergenic
1059334372 9:113559504-113559526 GCGTGTGGGCTTCTCCTTGCTGG + Intronic
1060140637 9:121206837-121206859 GAGGGTGGCCTGCGCCTGGGAGG - Intronic
1062207573 9:135345844-135345866 GCCTGTGATCTGCTCCGGGTTGG - Exonic
1062215036 9:135384539-135384561 GGGCGTGGCCGGCTCCTGGGGGG - Intergenic
1188033401 X:25289619-25289641 CCGTTTGACCTGCTCCTGTTTGG + Intergenic
1188156406 X:26748361-26748383 GCGTGTCGCCTGCTCCTCACTGG + Intergenic
1189146974 X:38665382-38665404 GCGTGTGGCCTGCAGGGGGTGGG + Intronic
1190495596 X:51025708-51025730 GGGTCTGTGCTGCTCCTGGTGGG + Intergenic
1190510330 X:51167873-51167895 GGGTCTGTGCTGCTCCTGGTGGG - Intergenic
1190760590 X:53434619-53434641 GCAAGTGGCCTGCTCCGCGTGGG + Intergenic
1200249211 X:154543312-154543334 GCCTGTGGCCAGCTTCGGGTTGG - Intronic