ID: 1168074370

View in Genome Browser
Species Human (GRCh38)
Location 19:53971563-53971585
Sequence GGCTGAAATCCCTGAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168074370_1168074381 14 Left 1168074370 19:53971563-53971585 CCCCCTCCTCAGGGATTTCAGCC 0: 1
1: 0
2: 2
3: 26
4: 320
Right 1168074381 19:53971600-53971622 TCTCTCAGGACTCAAGAGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 168
1168074370_1168074377 0 Left 1168074370 19:53971563-53971585 CCCCCTCCTCAGGGATTTCAGCC 0: 1
1: 0
2: 2
3: 26
4: 320
Right 1168074377 19:53971586-53971608 ACACCCCGAGGTCTTCTCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 89
1168074370_1168074382 15 Left 1168074370 19:53971563-53971585 CCCCCTCCTCAGGGATTTCAGCC 0: 1
1: 0
2: 2
3: 26
4: 320
Right 1168074382 19:53971601-53971623 CTCTCAGGACTCAAGAGTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168074370 Original CRISPR GGCTGAAATCCCTGAGGAGG GGG (reversed) Intronic
900242864 1:1625227-1625249 GGCTGAAGTCCCAGAGGGGAGGG + Intronic
900905151 1:5551900-5551922 GGCTGAGATTGCAGAGGAGGCGG + Intergenic
901629498 1:10641309-10641331 GCCGGAAGTCCCTGAGGAGGGGG + Intronic
901738600 1:11327902-11327924 GGGAGAGCTCCCTGAGGAGGAGG - Intergenic
902176523 1:14654822-14654844 GGCTGGCATCCCTGGAGAGGAGG - Intronic
903205763 1:21781485-21781507 GCCTGTAATCCCAGAAGAGGTGG + Intronic
903809469 1:26027167-26027189 GGCTGAGCTCCTTGAGGATGGGG - Intronic
904729036 1:32574343-32574365 GCCTGTAATCCCTGAGGCTGAGG + Intronic
904753525 1:32755300-32755322 TGAGGAAATCCCAGAGGAGGTGG + Intronic
904919941 1:33999214-33999236 GACTGCAATGCCAGAGGAGGAGG + Intronic
906708813 1:47914361-47914383 GCCTGAAATAGCTGAGGGGGAGG - Intronic
906741166 1:48186919-48186941 GCCTGACATTCCTGGGGAGGGGG + Intergenic
907048410 1:51313941-51313963 AGATGGAGTCCCTGAGGAGGAGG - Intronic
907319533 1:53593982-53594004 GGCTGAGATCCCTGTGGTTGAGG - Intronic
907798904 1:57744573-57744595 GGCTGAAGTCACCGAGGAAGTGG + Intronic
909191537 1:72558568-72558590 GGATGAAATGCCTGCTGAGGTGG + Intergenic
910432701 1:87174737-87174759 GGAAGAAATCTCTGTGGAGGAGG + Intergenic
911024537 1:93422985-93423007 AACTGAAATCCCTGAAAAGGAGG + Intergenic
912756509 1:112329199-112329221 GGCTGGGAGCCCTGAGGAGAGGG + Intergenic
915294740 1:154912085-154912107 GGCTGAGATTCCTGAGGTGGGGG - Intergenic
916792379 1:168136256-168136278 GGCTGGAATCCGTGAGGACCAGG - Intronic
916842774 1:168616646-168616668 CCCAGAAATCCCTGTGGAGGAGG + Intergenic
917346531 1:174033942-174033964 GGCAGCAATCCCTGAGGTGATGG + Intergenic
920606882 1:207397668-207397690 GGCTCAACTCCCTGACGTGGAGG + Intergenic
920691200 1:208147727-208147749 GCCTGAATTCTCTGAAGAGGGGG + Intronic
922665705 1:227466670-227466692 GGCTGAGATCTATGAGCAGGTGG + Intergenic
923035539 1:230282678-230282700 CGCTGGAATCACTGAGGCGGAGG - Intergenic
924196583 1:241614082-241614104 CGCTGGAATCCATGAGGTGGAGG + Intronic
924446763 1:244140100-244140122 ATCTGAAATGCTTGAGGAGGTGG - Intergenic
1063153273 10:3355722-3355744 AGCTGAAATCCCGGAGTGGGGGG + Intergenic
1065963256 10:30751217-30751239 GGCTGGATTTCCTGAGGAGTAGG - Intergenic
1066469234 10:35681948-35681970 TGCTGAGAGCCCTGAGGTGGAGG + Intergenic
1066721725 10:38346658-38346680 GACTGAAATTCCTGAGAAGGTGG - Intergenic
1067509575 10:46883985-46884007 GACTGACCTCTCTGAGGAGGAGG - Intergenic
1067652679 10:48167874-48167896 GACTGACCTCTCTGAGGAGGAGG + Intronic
1069620810 10:69836289-69836311 GGCTGGAATCCTGGAGGATGCGG - Intronic
1069993462 10:72328892-72328914 GCCAGACCTCCCTGAGGAGGTGG + Intergenic
1070631315 10:78086722-78086744 GGCTGAACTACCTGAGCAGGAGG + Intergenic
1071725075 10:88190463-88190485 GGATGATTTCCCAGAGGAGGTGG + Intergenic
1072907507 10:99467976-99467998 TGCTGGAGTCTCTGAGGAGGGGG + Intergenic
1074437597 10:113447190-113447212 GGCTGAAATCCTGGAGAAGTGGG - Intergenic
1074589792 10:114801887-114801909 GACTTAGATCCCTGAGGAAGAGG - Intergenic
1075384729 10:122047431-122047453 GGCTGAGACCCCTCAGGGGGGGG + Intronic
1075915839 10:126166324-126166346 GGCTGAAATGTATGAGCAGGTGG + Intronic
1076618748 10:131773497-131773519 GGTTGTCACCCCTGAGGAGGGGG + Intergenic
1077503996 11:2921883-2921905 GTCTGAGATCCCTGAGGAGTCGG - Intronic
1079097089 11:17517936-17517958 GGCTGAAGGTCCTGAGGAGGTGG + Intronic
1079451610 11:20603789-20603811 GGAAGAAATGGCTGAGGAGGAGG + Intronic
1082696011 11:56365542-56365564 GTCTGTAATCCCAGCGGAGGTGG + Intergenic
1083277772 11:61606874-61606896 GTCAGAATTCCCAGAGGAGGAGG + Intergenic
1083744442 11:64727343-64727365 AGCAGAGATCCGTGAGGAGGAGG - Exonic
1085190409 11:74615695-74615717 GGTTGAAAATCCTGGGGAGGTGG + Intronic
1085423140 11:76380874-76380896 GGCGGACTGCCCTGAGGAGGCGG - Exonic
1086272017 11:85079341-85079363 GCCTGAATTCCAAGAGGAGGAGG + Intronic
1086801621 11:91183689-91183711 GGCAGAAATCCCAGAGGGAGGGG - Intergenic
1087752277 11:102019997-102020019 CGCTGAAATCCAGGAGGTGGAGG + Intergenic
1088029126 11:105224663-105224685 GGCTGATGTCCCAGAGCAGGAGG - Intergenic
1089673682 11:120074456-120074478 GGCAGAGATCCCTGCTGAGGCGG - Intergenic
1089965024 11:122648570-122648592 TGCTGAAATCCGGGAGGCGGAGG + Intergenic
1090080873 11:123611802-123611824 AGGTGGCATCCCTGAGGAGGGGG + Intronic
1093464957 12:19439795-19439817 GGCTGAGCCCCCCGAGGAGGAGG + Exonic
1095635456 12:44428120-44428142 GGCAGAAATCTCTGTGGTGGTGG + Intergenic
1096411445 12:51379635-51379657 GGCTGAAGTCCCTGGTGAGCCGG - Exonic
1096622898 12:52875382-52875404 GGCTGGTCTCCCTGTGGAGGTGG - Intergenic
1096649350 12:53054258-53054280 GGCTGAAGCTCCTGGGGAGGAGG - Exonic
1098265133 12:68710569-68710591 CGCTGAAATCCAGGAGGTGGAGG + Intronic
1098611687 12:72466622-72466644 GGCTGAAATACATAAAGAGGAGG - Intronic
1098814228 12:75137236-75137258 GGATGAGATCCTTGAGGAGTTGG - Intronic
1102178424 12:110893397-110893419 GGCTGGACTCCCTGAAAAGGGGG - Intronic
1103408809 12:120695866-120695888 TGTTCAAGTCCCTGAGGAGGAGG + Intronic
1103607764 12:122099644-122099666 TGCTGAACTCCCTCAGGGGGAGG + Intronic
1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG + Intronic
1104423620 12:128657139-128657161 GGCCAAAATCACGGAGGAGGGGG - Intronic
1104618654 12:130292659-130292681 GGCTCAGGTCCCTGAAGAGGGGG + Intergenic
1104847280 12:131852824-131852846 GGCTGGACTCCATGAGGATGTGG - Intergenic
1105053420 12:133075890-133075912 CGCTGAAACCCAGGAGGAGGAGG + Intergenic
1105784306 13:23733462-23733484 GGCTGGAATCCAGGAGGAGCAGG + Intronic
1106433712 13:29705990-29706012 GGCAGAATGCCCTGAGCAGGTGG - Intergenic
1106999166 13:35523559-35523581 GGCAGAAATCACTCAGGAGGAGG + Intronic
1107302759 13:38983222-38983244 TACTGGAATCCCTGAGGGGGAGG - Intronic
1109117325 13:58405311-58405333 GGCAGAGATTCATGAGGAGGAGG - Intergenic
1109989404 13:70033868-70033890 GCCTGTAATCCCAGAGGTGGGGG - Intronic
1110802652 13:79717522-79717544 GGCTGAAATTCCTGATGCAGAGG - Intergenic
1113097795 13:106684261-106684283 GGTCGGAATCTCTGAGGAGGTGG + Intergenic
1113537782 13:111081930-111081952 GGCTGCAGCCCCTGTGGAGGGGG - Intergenic
1115693756 14:35874578-35874600 GGCTTAAACCCAGGAGGAGGAGG - Intronic
1117226244 14:53663322-53663344 GCCTGAAAACCCTGAGATGGGGG + Intergenic
1117313465 14:54551199-54551221 CACTGAAATCTCTGAGAAGGGGG - Intergenic
1117331857 14:54720563-54720585 GGCTTATATCCCTCAGGAGGAGG - Intronic
1118373662 14:65158477-65158499 GGATGGAAGCCCTGATGAGGGGG + Intergenic
1118837651 14:69487966-69487988 GGCCGGAACCCCTAAGGAGGAGG + Intronic
1119637708 14:76290297-76290319 AGCTACAATCCCTGAGGAGATGG + Intergenic
1120813125 14:88825039-88825061 GGCTGAAAATTGTGAGGAGGGGG - Intronic
1120970489 14:90203003-90203025 GCCTGAATTCCCAGTGGAGGAGG - Intergenic
1121407952 14:93730371-93730393 GGATGACATCTCAGAGGAGGTGG + Intronic
1121633724 14:95439754-95439776 GGCAGAATTCCCGGAGAAGGAGG - Exonic
1121914462 14:97824024-97824046 GGTTGAATTCGTTGAGGAGGAGG + Intergenic
1122283766 14:100639051-100639073 GGCTGCACTCCCTGAACAGGTGG - Intergenic
1122836101 14:104431834-104431856 GGCTGAAGCTCCTGAGGTGGCGG + Intergenic
1122895942 14:104757048-104757070 GGCTCAAAGACCAGAGGAGGAGG - Intronic
1123200466 14:106658338-106658360 GGGTGAGATGCCTGAGGAGAGGG + Intergenic
1124781648 15:32641857-32641879 TGCTAAAATCCTTGAGGTGGAGG + Intronic
1124834290 15:33180831-33180853 GGCTGAAACCCTGGAGGGGGAGG - Intronic
1125094834 15:35839067-35839089 GGCTGAATCCCCTGAGCAGTTGG - Intergenic
1125182937 15:36897927-36897949 AGCTGAAGTCCCTTTGGAGGAGG + Intronic
1125762130 15:42103957-42103979 GGGTGAAATCCCTTAGGTGTGGG + Intergenic
1125894007 15:43286961-43286983 AGCTGAGATGCCTGAGCAGGTGG + Intronic
1128087711 15:64897372-64897394 TGCTGAGGGCCCTGAGGAGGGGG + Intronic
1128356141 15:66928170-66928192 TGATGAGATTCCTGAGGAGGGGG - Intergenic
1129917617 15:79288229-79288251 GGCTATAATCCCTGGGGAGTAGG + Intergenic
1133191421 16:4136337-4136359 GGCAGAAACACCTGAGAAGGGGG + Intergenic
1133267116 16:4591908-4591930 GGCTGAAAGCACTGAGGAGGAGG + Intronic
1133774703 16:8887486-8887508 GGCTGAAGGCCTGGAGGAGGGGG + Intergenic
1134788882 16:16970486-16970508 GGCAGAAATCCATGAGAAAGAGG - Intergenic
1135504010 16:23020753-23020775 GGCTTGAATCCGTGAGGCGGAGG - Intergenic
1136667200 16:31822340-31822362 TGCTGGAACCCCTGAGGAAGAGG - Intergenic
1136772858 16:32857119-32857141 GGCTGCAATGCCCGTGGAGGAGG + Intergenic
1136897756 16:34004400-34004422 GGCTGCAATGCCCGTGGAGGAGG - Intergenic
1136938918 16:34501240-34501262 GGCAGAAAGCCGTGAGGCGGGGG + Intergenic
1136960902 16:34847316-34847338 GGCAGAAAGCCGTGAGGCGGGGG - Intergenic
1137469923 16:48745102-48745124 GGCTGAAATCCCTGAAGGACAGG + Intergenic
1137761270 16:50942401-50942423 CTCTGCAATCCCTGAGGAGACGG + Intergenic
1137933488 16:52610588-52610610 GGCTGAACTCAATGAGAAGGTGG - Intergenic
1138490488 16:57373495-57373517 GGGGGCACTCCCTGAGGAGGGGG - Intronic
1138778436 16:59753869-59753891 GACTGAAATCCCATAGGAGACGG + Intronic
1139800563 16:69519390-69519412 GGCTTGAATCTCGGAGGAGGAGG - Intergenic
1140799289 16:78470611-78470633 GGCTTGAATCCAGGAGGAGGAGG - Intronic
1141718800 16:85743182-85743204 AGCTGAAATGTCTGAGAAGGAGG + Intronic
1203075282 16_KI270728v1_random:1119229-1119251 GGCTGCAATGCCCGTGGAGGAGG + Intergenic
1143855829 17:9848024-9848046 GACAGAATTCCCTGAGGATGTGG - Intronic
1143929075 17:10401677-10401699 GACTGAAAGAGCTGAGGAGGAGG - Exonic
1144144738 17:12386550-12386572 GGCTTAAATCCCTGATCAAGGGG + Intergenic
1145120097 17:20251142-20251164 GGCTTAAATCCAGGAGGCGGAGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147365022 17:39953513-39953535 GGCTGAGATCTCCCAGGAGGAGG - Intergenic
1147723852 17:42554555-42554577 GGCGCAGAACCCTGAGGAGGTGG + Exonic
1148338680 17:46860137-46860159 AGCTGTAACCCCTGAGGAGCTGG + Intronic
1149637355 17:58181545-58181567 GGAAGGAATCTCTGAGGAGGGGG + Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150424797 17:65068721-65068743 GCCTGTAATCCCTGAGGCTGAGG - Intergenic
1151104031 17:71591302-71591324 GGCTGACTTCCCTGATGAAGAGG + Intergenic
1151275255 17:73029383-73029405 GGCTTCAATCCCTGAGCAGCAGG - Intronic
1151722893 17:75868229-75868251 GGCTTGAATCCATGAGGCGGAGG - Intergenic
1152543498 17:80989154-80989176 GGCTGAAGTCCCTGATCTGGGGG + Intergenic
1152757945 17:82094886-82094908 GGTTGAAATGCCTGGGGTGGGGG + Intronic
1153188862 18:2516235-2516257 GGGGGAAATCCCAGAGGAGGTGG + Intergenic
1155680787 18:28483171-28483193 TGCTTGAATCCATGAGGAGGAGG + Intergenic
1156023915 18:32630271-32630293 TGCTGAAATCCTAGAGGAGTGGG - Intergenic
1156076859 18:33289037-33289059 GGCTGAAATACTAGAGGAGGAGG - Intronic
1156501342 18:37561146-37561168 GGCTGAAATCCCTGCAGCTGTGG + Intronic
1157340260 18:46771841-46771863 GGCTGAAGTCACAGAGGAGCAGG - Intergenic
1157434251 18:47654998-47655020 GGCTGAAAGCCCAGAGTAGGAGG - Intergenic
1157962986 18:52177892-52177914 CGCTTAAATCCAGGAGGAGGAGG - Intergenic
1159356848 18:67346918-67346940 GCCTGAGATCCCTGAAGAGGAGG + Intergenic
1159909064 18:74126669-74126691 GACTGAAATCCCTGAGGAGCTGG + Intronic
1160972545 19:1775931-1775953 GGCTGAGGTCCCTGGGGAGGGGG - Exonic
1161260134 19:3333066-3333088 GGCTTAAATCCGGGAGGCGGAGG - Intergenic
1161802012 19:6421563-6421585 AGCTGGAAGCACTGAGGAGGTGG - Intronic
1162358317 19:10201164-10201186 CGTTGAAGTCCCTGAGTAGGAGG - Intronic
1162461606 19:10817108-10817130 GGCAGCCACCCCTGAGGAGGAGG + Intronic
1163036835 19:14574663-14574685 GGGTGGAATCCATCAGGAGGAGG - Intergenic
1163995125 19:21038509-21038531 CGCTGAAACCCAGGAGGAGGAGG - Intronic
1164532064 19:29056300-29056322 TGCTGGAATCCTTGAGGAGGTGG + Intergenic
1164802061 19:31085111-31085133 GACTGAACTCCCTGAGGACAGGG + Intergenic
1165441522 19:35831095-35831117 GGCTGAAGTCCCTCAGGGAGCGG + Exonic
1166301428 19:41913876-41913898 GGCTGAAGTGCCTGAGGGGAGGG - Intronic
1166730763 19:45057819-45057841 GGCAGAAAAGCCAGAGGAGGAGG + Exonic
1167783949 19:51621162-51621184 AGCTGACATCCCAGAGGAGATGG + Intronic
1168074370 19:53971563-53971585 GGCTGAAATCCCTGAGGAGGGGG - Intronic
1168199920 19:54806929-54806951 GGCTTAAACCCAGGAGGAGGAGG + Intronic
925039894 2:724106-724128 GGGTGAAAGCCCTGAGGACCTGG - Intergenic
926740337 2:16105300-16105322 GGCTGAAATCCCAGACGCAGAGG - Intergenic
927220203 2:20700193-20700215 AGCTGAAAGCCCTGGAGAGGGGG + Intronic
929951372 2:46412086-46412108 GCCTGAGAGCCCTGAGAAGGAGG - Intergenic
933544635 2:83695040-83695062 GGGTGAAATGCCTGTGAAGGGGG - Intergenic
933951431 2:87333602-87333624 GGCTGAAACCCGGGAGGTGGAGG + Intergenic
934235673 2:90229869-90229891 GGCTGAAACCCAGGAGGTGGAGG + Intergenic
936453612 2:112652889-112652911 GGCTGAAATCTCCTAGAAGGTGG + Intronic
936510751 2:113143589-113143611 TGCTGAAACCCAGGAGGAGGAGG + Intergenic
937656307 2:124380983-124381005 GGCTGGAATCTCTGAGAAGGTGG + Intronic
937958576 2:127437825-127437847 GGCTAAAATCTCTTTGGAGGAGG + Intronic
938097663 2:128474115-128474137 GGCTCAAACCCCTGAGGAGCAGG - Intergenic
940176532 2:150883386-150883408 GGCTGAAATCCCACAGGCTGTGG + Intergenic
943445236 2:187977211-187977233 GCCTAAAATCTCTGAGGAGAGGG + Intergenic
944267496 2:197744923-197744945 GAATGAGGTCCCTGAGGAGGAGG + Intronic
944412438 2:199457712-199457734 GGCTGAGAACCCGGAGGCGGCGG + Exonic
944429026 2:199613554-199613576 GGCAGAAATCCCTGGGCTGGTGG - Intergenic
944955578 2:204804143-204804165 GGCTGAAGCCCATGAGGTGGAGG + Intronic
945320122 2:208411412-208411434 GCCTTAAATCCCTGAGGAATGGG + Intronic
945935423 2:215898632-215898654 GGATGGAGACCCTGAGGAGGTGG - Intergenic
946314369 2:218899919-218899941 GAATGAAATCCCTGAGGCAGTGG - Intergenic
947069972 2:226278287-226278309 GGCTTAAATCCATGAGGTGGAGG - Intergenic
947156963 2:227172293-227172315 GCCTGACATTCCTGATGAGGCGG + Intronic
947648834 2:231766908-231766930 GGCTGGAATCCGGGAGGCGGAGG + Intronic
1169279031 20:4251458-4251480 GGCTGAAATCCGGGAAGGGGTGG + Intergenic
1169349463 20:4856441-4856463 CGCTGATCTCCCGGAGGAGGAGG - Exonic
1169455224 20:5746626-5746648 CGCTTGAATCCCTGAGGCGGAGG + Intergenic
1169542152 20:6611558-6611580 GGCTTAAATCCAGGAGGTGGAGG - Intergenic
1171376001 20:24694411-24694433 GGCTGAAATCCAGGCAGAGGGGG + Intergenic
1171725887 20:28620597-28620619 CTCTGAGATCCATGAGGAGGAGG + Intergenic
1172414877 20:34757342-34757364 TGCTGAAATCCCTGGGGAAGTGG + Exonic
1173858997 20:46269829-46269851 GCTGGAAGTCCCTGAGGAGGTGG - Intronic
1175458974 20:59136627-59136649 GGATGAAAGCTCAGAGGAGGGGG - Intergenic
1175905671 20:62378219-62378241 GGCTGGGAACCCTGAGGAGCTGG + Intergenic
1178073455 21:28993899-28993921 GGCTCAAACTTCTGAGGAGGTGG - Intergenic
1178511974 21:33212923-33212945 GACTGAAGTCCCTGAGCAAGAGG - Intergenic
1178962733 21:37082295-37082317 GTCTGATATCCTTGAGGAGGGGG + Exonic
1179614276 21:42571691-42571713 GGCTGGTATAACTGAGGAGGAGG - Intronic
1180203196 21:46239742-46239764 GGATGAAATTTCTGAGGAGTAGG + Intronic
1181985432 22:26797028-26797050 GGCTGCTTTCCCTGAGGCGGCGG - Intergenic
1182059434 22:27386460-27386482 GGCTGGAATCCCTGAGGGCAGGG + Intergenic
1183345750 22:37306822-37306844 AGCTGAAACAGCTGAGGAGGAGG - Intronic
950170756 3:10837752-10837774 GCCTGAAATTCCTGCAGAGGAGG + Intronic
953152297 3:40335500-40335522 GGCTTGAATCCCAGAGGCGGCGG + Intergenic
953397073 3:42581893-42581915 GGCTAAGATTGCTGAGGAGGCGG - Exonic
954106113 3:48410624-48410646 GGCTGGTGTCCCTGTGGAGGAGG - Intronic
954400070 3:50314881-50314903 GGCATGAATCCTTGAGGAGGGGG - Intergenic
954633384 3:52058639-52058661 GGGTGACATCCCTGAGGGGCAGG + Intergenic
954795287 3:53158242-53158264 GGCTGCAAACCTGGAGGAGGAGG + Intronic
955292584 3:57706246-57706268 GACTGAGATCACTGGGGAGGTGG - Intergenic
956966374 3:74465871-74465893 GGCTGACATCCAGGAGGTGGAGG + Intronic
959536506 3:107492389-107492411 GGCTGTAATCCTTGAGGGGAGGG + Intergenic
961057030 3:123797997-123798019 GGCAGAATTCCCTGGGAAGGTGG + Intronic
961636592 3:128336675-128336697 GGAGGACTTCCCTGAGGAGGTGG - Intronic
964258055 3:154801272-154801294 TGCTTGAATCCCTGAGGTGGAGG + Intergenic
964426057 3:156555026-156555048 GGCTGAAATCCTGCAGGAGCAGG + Exonic
965682127 3:171262308-171262330 GGCTGATATCACAGAGGAGGTGG - Intronic
966734799 3:183179958-183179980 GGGTGAGAATCCTGAGGAGGGGG + Intronic
968455154 4:694014-694036 GGCTGAACAACATGAGGAGGTGG - Intergenic
968485991 4:862211-862233 GGCTGAGATCACTGATGAAGGGG + Intronic
968673501 4:1864619-1864641 GGCTGTAGGCCCTGAGTAGGCGG + Intergenic
969338598 4:6526867-6526889 GGCCTGATTCCCTGAGGAGGGGG + Intronic
969432049 4:7161117-7161139 GGCAGAATTCCTGGAGGAGGTGG + Intergenic
969657219 4:8505270-8505292 GGCTGCAGCCCCTGAGGAGGTGG + Intergenic
969670494 4:8587481-8587503 GGCTGAAGTACAGGAGGAGGAGG + Exonic
971104564 4:23508704-23508726 GGATGGAATCCCTGAGGATATGG - Intergenic
971266453 4:25100193-25100215 GGAAGAAAGCCATGAGGAGGGGG - Intergenic
976283682 4:83349933-83349955 GGCTTGAATCCGGGAGGAGGAGG - Intergenic
977583496 4:98749245-98749267 GGAAGAAAACCCTGAGGAAGGGG + Intergenic
979437638 4:120712529-120712551 AGCTGTCATCCCTGAGGAGATGG - Intronic
980395250 4:132205015-132205037 GACTGAATTCCCTGAGGATGGGG - Intergenic
980623496 4:135341946-135341968 GGCAGAGATACCTGAGGAAGTGG + Intergenic
980826274 4:138077218-138077240 GCCTGTAATCCCTGAGGGTGAGG + Intergenic
982222213 4:153134698-153134720 CGCTGAAATCCGGGAGGCGGAGG - Intergenic
984093170 4:175401312-175401334 GGCTGAGATCCCTTATGAAGAGG + Intergenic
986252401 5:6072323-6072345 GGCTTAAATAACTGAGCAGGTGG - Intergenic
988220695 5:28343470-28343492 GGCTTGAATCCATGAGGCGGAGG - Intergenic
989676714 5:43981679-43981701 GTCTGAGTTCCCTGAGGAAGGGG - Intergenic
993678132 5:90842450-90842472 GCCTGTAATCCCAGCGGAGGCGG + Intronic
996929570 5:128869740-128869762 GGAAGACATCCCTGAGTAGGTGG - Intronic
997463514 5:134071493-134071515 GGCTGAGAGCCCTGAGGCTGAGG - Intergenic
997604452 5:135164000-135164022 GGGTGAGACCACTGAGGAGGTGG + Intronic
997733129 5:136194927-136194949 GGCTGAAAGTCCTGGTGAGGAGG - Intergenic
998454590 5:142261556-142261578 GGCAGAGACCCCTGAGGAGGAGG - Intergenic
998472563 5:142394422-142394444 GGTTCGATTCCCTGAGGAGGAGG - Intergenic
999223681 5:150001888-150001910 GGCTGAAAGCCTTGTGGAGAAGG - Intronic
999309413 5:150542309-150542331 GAATGAACTCACTGAGGAGGAGG + Intronic
1001871131 5:175156949-175156971 GGCTGAGATTCCTGAGGAGCAGG + Intergenic
1001929137 5:175660194-175660216 GGAAGAAATCCCTGATGATGGGG + Intronic
1002435143 5:179226904-179226926 GGATGGAATGCCTGAGCAGGAGG + Intronic
1004420082 6:15461427-15461449 AGCTGTAATCCAGGAGGAGGAGG + Intronic
1005358338 6:25006890-25006912 GGCTGAAAGCCTAGAGGAGCTGG + Intronic
1005905821 6:30260805-30260827 GGATGAAGTCCCTGAGGAAATGG + Intergenic
1005937493 6:30534804-30534826 GACTGAGGTCCCTGAGGAAGAGG + Intergenic
1007586945 6:42996529-42996551 GGAAGATATCCCTGAAGAGGTGG - Intronic
1007637627 6:43308681-43308703 CGCTGGATTCCCTGAGGACGCGG - Intronic
1008374704 6:50778413-50778435 CTTTGAAATCCCTGAGTAGGGGG - Intergenic
1012182817 6:96176222-96176244 GGCTGAAATCCCACAGTATGAGG - Intronic
1012395961 6:98797385-98797407 GGATGATATCCCTTAGGAAGAGG + Intergenic
1014608676 6:123513129-123513151 GGCTGAAACTCTGGAGGAGGAGG - Intronic
1015920143 6:138258235-138258257 GACAGAAAACCCTGAAGAGGCGG - Intronic
1017270198 6:152495171-152495193 GGGCGAACTCCCTGAGGAGTGGG - Intronic
1017579982 6:155853597-155853619 CGCTGAAATTCATGAGGAGTAGG - Intergenic
1017962065 6:159232123-159232145 GACAGAAATCACTGGGGAGGAGG + Exonic
1019341075 7:509223-509245 CGCTGAAATCCCAGATGAAGGGG + Intronic
1019689071 7:2399819-2399841 GGCTCAACTCCCTGAGTAGCTGG - Intergenic
1020251999 7:6476701-6476723 AGATGACATCCCAGAGGAGGTGG - Intronic
1025087376 7:56034244-56034266 GGCTGAGCCCCCGGAGGAGGAGG - Intronic
1027058712 7:75068234-75068256 TGCTTAAATCCAGGAGGAGGAGG + Intronic
1027252559 7:76408373-76408395 AGCTGAGAACCATGAGGAGGGGG + Intronic
1029452158 7:100647283-100647305 TCCTGAAATCCCAGCGGAGGTGG + Exonic
1029503737 7:100949759-100949781 GGCTGTAAGGCCTGGGGAGGGGG + Intronic
1030088651 7:105838491-105838513 GGCTGAAATCCCTAGGGGTGTGG - Intronic
1030629802 7:111883434-111883456 GGCTCCAAATCCTGAGGAGGAGG - Intronic
1032405889 7:131655106-131655128 GGATGACATGGCTGAGGAGGGGG + Intergenic
1032539318 7:132690200-132690222 GCCTGTAATCCCAGATGAGGCGG - Intronic
1032669194 7:134067939-134067961 GGATGAAATCAGTGTGGAGGGGG - Intergenic
1034324071 7:150213615-150213637 GGATGAAATGCCCCAGGAGGGGG + Intergenic
1034383744 7:150720804-150720826 GGCTGAAGTCCCCCAGGAGCTGG + Exonic
1034537180 7:151732774-151732796 TGCTGAAACCCGGGAGGAGGAGG - Intronic
1035547460 8:494430-494452 GGAGGAAGTCACTGAGGAGGTGG - Intronic
1038138664 8:24818788-24818810 GGCTGAGAGCACTGAGGAGCAGG - Intergenic
1038722194 8:30047097-30047119 CGCTGGAACCCCGGAGGAGGAGG - Intergenic
1039890587 8:41682956-41682978 GGCTGGAATCCCCAAGGGGGTGG + Intronic
1042367299 8:67952195-67952217 GGCTGAAATCCCGGCGCGGGGGG - Exonic
1043303349 8:78762469-78762491 GGCGGACTGCCCTGAGGAGGCGG - Intronic
1043454284 8:80398448-80398470 GGCTGAAATCCTTGCTGAGGTGG + Intergenic
1043916119 8:85924334-85924356 GGCTGAAATTGCTTAGAAGGTGG - Intergenic
1046037546 8:108862226-108862248 GGTAGAAGTGCCTGAGGAGGAGG - Intergenic
1046652437 8:116851985-116852007 CGCTTAACTCCCTGAGGTGGTGG + Exonic
1047098454 8:121649682-121649704 GGCTGAAATCCTTGTCGGGGTGG + Intergenic
1047381133 8:124364350-124364372 GTCTGAGAGCACTGAGGAGGAGG + Intronic
1048218757 8:132521337-132521359 CATTGAAATCCTTGAGGAGGTGG - Intergenic
1049264672 8:141661083-141661105 GGCTGAGATACCAAAGGAGGAGG + Intergenic
1049444490 8:142623760-142623782 TGCTGAGATCACAGAGGAGGGGG + Intergenic
1049597621 8:143492002-143492024 GGCTCGTATCCCTGGGGAGGAGG + Intronic
1049620226 8:143594814-143594836 GGCTGGAGCCCCTGAGGAAGCGG + Intronic
1050365607 9:4870773-4870795 GGGAGAAATCCTTGGGGAGGAGG + Intronic
1053283427 9:36836026-36836048 GGCTGAATGTCATGAGGAGGGGG + Exonic
1053945922 9:43310792-43310814 GGCAGAAAGCCGTGAGGCGGGGG - Intergenic
1055470772 9:76608114-76608136 CCCTCCAATCCCTGAGGAGGGGG - Intergenic
1055766024 9:79664428-79664450 GGTTATAATCCCTGAGGCGGGGG - Intronic
1055862338 9:80767655-80767677 GGATGAAAGCCCAGAGAAGGGGG + Intergenic
1057233524 9:93339995-93340017 AGCTGAAAGCCCTTAGAAGGTGG - Intronic
1060221122 9:121764661-121764683 GGCTGTAAGCCCTGAGCTGGAGG - Intronic
1060817278 9:126641721-126641743 GACTGGAATCCCCCAGGAGGAGG - Intronic
1060956693 9:127646455-127646477 GACTGAGGTCCCTGAGGAAGAGG - Intronic
1060969015 9:127727417-127727439 GGCTGAGGCCCCTGAGGAGGAGG + Exonic
1061644026 9:131984479-131984501 GGCCCAAATCCCTGTGAAGGAGG - Intronic
1061684994 9:132268415-132268437 GGCTTAAATCCAGGAGGCGGAGG + Intronic
1061805734 9:133136851-133136873 GGCTTAAATCCAGGAGGTGGAGG + Intronic
1061818272 9:133208775-133208797 GGCTGGGAGCCCTGAGCAGGGGG - Intronic
1062242180 9:135546583-135546605 GGCTGGGAGCCCTGAGCAGGGGG + Intronic
1203589057 Un_KI270747v1:39372-39394 GGCAGAAAGCCGTGAGGCGGGGG - Intergenic
1187300475 X:18044323-18044345 GGCTGCAATGACTGGGGAGGTGG + Intergenic
1189279546 X:39811606-39811628 GGCTGACATCAGTGGGGAGGAGG + Intergenic
1190527576 X:51343380-51343402 GGCTGACCTCCCTGAGCAAGGGG - Intergenic
1192050038 X:67716415-67716437 GGATGAAAGGCCTGAGAAGGAGG + Intronic
1192370381 X:70508045-70508067 GAGTGAAATCCCAGAGGAAGCGG - Intergenic
1194179472 X:90694968-90694990 GGCTGAACACCCTGAGGACTAGG + Intergenic
1195424878 X:104717561-104717583 AGCTGAGTTGCCTGAGGAGGGGG + Intronic
1195878597 X:109568982-109569004 GCCTGAAATCCTTCAGCAGGTGG - Intergenic
1197862429 X:130984897-130984919 GGCTCTGAACCCTGAGGAGGTGG + Intergenic
1198137392 X:133767729-133767751 GGCTGGAGTCCCTGTGGTGGTGG - Intronic
1199019986 X:142868151-142868173 TGCTCAAAACCCTGAGGAGTGGG + Intergenic
1199535938 X:148903402-148903424 AGATGAAATCCCTGTGGAGAAGG + Intronic
1199745963 X:150772124-150772146 GGCTGAAAACACTGAGAAGCTGG - Intronic
1200526136 Y:4277141-4277163 GGCTGAACACCCTGAGGACTAGG + Intergenic