ID: 1168076418

View in Genome Browser
Species Human (GRCh38)
Location 19:53982828-53982850
Sequence CAGGAAAACCACGCCTGTGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168076411_1168076418 14 Left 1168076411 19:53982791-53982813 CCAAGGAGGCCGCCGCCTCCAAC 0: 1
1: 0
2: 4
3: 15
4: 183
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076415_1168076418 -4 Left 1168076415 19:53982809-53982831 CCAACACCAACACGCTCAACAGG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076407_1168076418 27 Left 1168076407 19:53982778-53982800 CCCGGGACCCTGGCCAAGGAGGC 0: 1
1: 0
2: 8
3: 38
4: 323
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076408_1168076418 26 Left 1168076408 19:53982779-53982801 CCGGGACCCTGGCCAAGGAGGCC 0: 1
1: 0
2: 10
3: 19
4: 336
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076410_1168076418 19 Left 1168076410 19:53982786-53982808 CCTGGCCAAGGAGGCCGCCGCCT 0: 1
1: 0
2: 0
3: 20
4: 224
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076414_1168076418 -1 Left 1168076414 19:53982806-53982828 CCTCCAACACCAACACGCTCAAC 0: 1
1: 0
2: 1
3: 20
4: 322
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076405_1168076418 28 Left 1168076405 19:53982777-53982799 CCCCGGGACCCTGGCCAAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 246
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076412_1168076418 5 Left 1168076412 19:53982800-53982822 CCGCCGCCTCCAACACCAACACG 0: 1
1: 0
2: 1
3: 32
4: 666
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076409_1168076418 20 Left 1168076409 19:53982785-53982807 CCCTGGCCAAGGAGGCCGCCGCC 0: 1
1: 0
2: 2
3: 25
4: 219
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076413_1168076418 2 Left 1168076413 19:53982803-53982825 CCGCCTCCAACACCAACACGCTC 0: 1
1: 0
2: 1
3: 28
4: 484
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076404_1168076418 29 Left 1168076404 19:53982776-53982798 CCCCCGGGACCCTGGCCAAGGAG 0: 1
1: 0
2: 2
3: 24
4: 190
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99
1168076417_1168076418 -10 Left 1168076417 19:53982815-53982837 CCAACACGCTCAACAGGAAAACC 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG 0: 1
1: 0
2: 0
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168076418 Original CRISPR CAGGAAAACCACGCCTGTGT AGG Exonic
903943234 1:26945927-26945949 CAGGAAAACAATGCCAGTGTTGG + Intronic
908786181 1:67736661-67736683 CAGGAAAACCATCCATGTGGTGG + Intronic
909879166 1:80850773-80850795 GAGGAAAATAACTCCTGTGTTGG - Intergenic
910620530 1:89248584-89248606 AAGGAAAACCACTTCTGTGAAGG + Intergenic
920388258 1:205582815-205582837 GACAAAAACCACCCCTGTGTTGG - Intronic
921893976 1:220379987-220380009 CAGGACAGGCACTCCTGTGTTGG - Intergenic
1064457460 10:15501397-15501419 CAGAAAGCCCACGCCTGTCTAGG + Intergenic
1065848534 10:29766674-29766696 CAGGACAACCACGCCCATGAAGG + Intergenic
1070579762 10:77710606-77710628 CAGGAAAACGATGTCTGTATGGG - Intergenic
1071365599 10:84897348-84897370 AAGCAAAACCACACCTGAGTAGG - Intergenic
1074184780 10:111091473-111091495 CAGGAAAGCCACGGCTGTGCTGG + Intergenic
1074448211 10:113537801-113537823 GAGGAAAAACAGGCCTGGGTGGG - Intergenic
1078148389 11:8738118-8738140 CAGGAATAACACGCTTGAGTAGG + Intronic
1083675513 11:64322784-64322806 CAGGGAAGCCACGCCTGTGATGG + Intergenic
1085305676 11:75484403-75484425 CTGGAGACCCACGCCTGGGTAGG - Intronic
1089652462 11:119923233-119923255 GAGGAAAACCAGGACTGTGTGGG - Intergenic
1092830739 12:12442075-12442097 CAGGGAAACCACACCTGGGGAGG - Intronic
1093517416 12:20005048-20005070 CTGGAACACTACGCATGTGTGGG - Intergenic
1094286330 12:28798558-28798580 TAGGAAAACCAGGCCTGGGCAGG + Intergenic
1099169461 12:79346546-79346568 CAGCAAAAGCACTCATGTGTTGG + Intronic
1100704697 12:97187182-97187204 CAGGAATACCAACCCTGTGATGG - Intergenic
1102879034 12:116470165-116470187 CAGGAAAACAATGCCTATTTTGG + Intergenic
1107710438 13:43145653-43145675 CAGGAACACCACATCTGTGTAGG + Intergenic
1107904765 13:45051644-45051666 AAGGAAAGCCAGGCCTGTGAGGG - Intergenic
1113565502 13:111317392-111317414 CAGGAAAGCCAGGCCTGAGATGG + Intronic
1115342982 14:32311887-32311909 CAGGAAATCCATTCCTGTGGTGG + Intergenic
1125718269 15:41832106-41832128 CAGGAAACCAGCACCTGTGTTGG + Intronic
1127843064 15:62846989-62847011 GCGGAAAACCCTGCCTGTGTGGG + Intergenic
1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG + Intronic
1133213202 16:4274116-4274138 CAGGAAGCCCACGCCTGCCTTGG + Intergenic
1133659634 16:7903736-7903758 CAGGAAAAACTGGCCTGTTTGGG - Intergenic
1138178231 16:54923052-54923074 CAGGAAAAGAACCCCTGTGCAGG + Intergenic
1138477583 16:57281225-57281247 CAGAAAAATCACTCCTGTGGAGG + Intronic
1140269784 16:73455154-73455176 TATGAAAACCAGGTCTGTGTAGG - Intergenic
1146008748 17:29178458-29178480 CAGGAAAACCATGGCTTTGGGGG - Intronic
1147232171 17:39027443-39027465 CAGGAAAACCAGGGCTCAGTCGG - Intergenic
1147649790 17:42055369-42055391 CAGGAAAAGCAAGGCTGTCTGGG - Intronic
1149840875 17:59964165-59964187 CGGGAAAAGCACGGCAGTGTGGG - Intronic
1151598842 17:75094090-75094112 CAGCACACCTACGCCTGTGTCGG - Intronic
1155179427 18:23331178-23331200 AAGGAAAAGCGCGCCCGTGTGGG + Intronic
1157860540 18:51136923-51136945 CTGGAAATTCACGCATGTGTGGG + Intergenic
1158634121 18:59140873-59140895 CAGGAAAAATACGACTATGTAGG + Intronic
1158638528 18:59182225-59182247 AAGTAAAACCTCCCCTGTGTGGG + Intergenic
1163264179 19:16208337-16208359 CAGGAAAAGCACGGTTATGTGGG - Intronic
1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG + Exonic
1168149718 19:54439111-54439133 CAGGAAAACCTGACCTGTGTTGG + Intergenic
926303494 2:11620261-11620283 CAGGAAACCCACGCCTGTAGTGG + Intronic
929348531 2:40918174-40918196 CAGGAAAAGTAGGCATGTGTAGG + Intergenic
936630633 2:114199095-114199117 CAGGAAAGCCTTGGCTGTGTGGG - Intergenic
936919471 2:117672813-117672835 CAGGAAAATCAGGCGTGGGTGGG - Intergenic
937368590 2:121282895-121282917 CTGGAAAACCTGCCCTGTGTGGG + Intronic
943802055 2:192072860-192072882 CAGGAAAACCACCTCTATATAGG + Intronic
947375181 2:229488743-229488765 CAGGAAAGCCAGGCCTGAATGGG - Intronic
1171994084 20:31718853-31718875 CAAGCAAACCATGCCTGTGAAGG - Intronic
1182799771 22:33022536-33022558 CAGGAGATCAAGGCCTGTGTGGG - Intronic
950088922 3:10281056-10281078 CAGTGAAACCTCACCTGTGTGGG + Exonic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
950545903 3:13637774-13637796 CAGGTAGACCACACCCGTGTAGG - Exonic
953980739 3:47411744-47411766 CTGGAAAACCAGGTCTGTCTTGG + Intronic
954592880 3:51798824-51798846 CAGGATAGCAACCCCTGTGTTGG + Intergenic
955112287 3:55960832-55960854 CTGTAAAACCACCCATGTGTTGG + Intronic
955155163 3:56409388-56409410 TAGGAAAATCATGACTGTGTGGG + Intronic
959698474 3:109274828-109274850 GAGGACAAACACTCCTGTGTGGG + Intergenic
960718309 3:120599503-120599525 CAGGAAATCCAAGCAGGTGTGGG + Intronic
961025041 3:123548064-123548086 CAGGAAAAACAAGCCTGTGGTGG + Intronic
962008651 3:131372238-131372260 CAGGATAACAACCCCTGGGTGGG + Intergenic
963123744 3:141797068-141797090 CAGCAAACCAACGCCAGTGTGGG + Intronic
964454937 3:156853509-156853531 CAGCAAAAACTCTCCTGTGTAGG - Intronic
966970709 3:185042872-185042894 AAGGAATACCAATCCTGTGTGGG + Intronic
970119377 4:12735567-12735589 CAGGGTAGCCATGCCTGTGTGGG - Intergenic
974686714 4:65241431-65241453 CACGGAACCCACGCCTGTGCTGG - Intergenic
976839136 4:89410819-89410841 CAGGAAAAGCAGGGCAGTGTTGG + Intergenic
977376900 4:96217010-96217032 CAGGAAGAGCACACCTGTGTCGG - Intergenic
978740353 4:112131041-112131063 CAGGAAAACAGCCACTGTGTAGG - Intergenic
981248479 4:142569352-142569374 CAAGCAAACCACTCCTTTGTGGG - Intronic
982816153 4:159887428-159887450 CAGGCAATCCAAGCCTGTGCTGG + Intergenic
997531625 5:134584938-134584960 CTCTAAAACCACACCTGTGTCGG + Intergenic
998433141 5:142083885-142083907 CAGGAAACCCAGGCCTTGGTGGG - Intergenic
999765579 5:154738130-154738152 TAGGTAAACCATGCGTGTGTGGG + Intronic
999781102 5:154851065-154851087 CAGGAAAGGCATGCCTGTGGAGG + Intronic
1001895555 5:175376848-175376870 CAGGAAAACCACTTCTGAGTGGG - Intergenic
1003881637 6:10484357-10484379 GAGAAAAACCACGTCTGGGTTGG + Intergenic
1003981928 6:11397890-11397912 GAGGACAACCATGACTGTGTGGG + Intergenic
1005306459 6:24518728-24518750 CTGGAAAGCTAGGCCTGTGTGGG - Intronic
1006438453 6:34039195-34039217 CAGGAAAACCAGCCCTGGGGAGG - Intronic
1007498258 6:42276747-42276769 CAGGAAAGCCAGGGCTGTGAAGG - Intronic
1011624349 6:89271194-89271216 CAGGACACCCAGGCCTGTGGTGG + Intronic
1023376141 7:39557462-39557484 CAGGGAAACCCCACCTCTGTTGG - Intergenic
1023524245 7:41082501-41082523 CAGCAAAACCTTGCTTGTGTGGG + Intergenic
1024542150 7:50484779-50484801 CAGGAAAAGGACCCTTGTGTTGG + Intronic
1024830754 7:53453098-53453120 CATAAAAACCACTCCTTTGTTGG + Intergenic
1028898566 7:96069607-96069629 CATGAAAATCATGCCAGTGTGGG + Intronic
1029211032 7:98908621-98908643 CAGGAACACCACCCCTGGGTCGG - Intronic
1031794026 7:126148898-126148920 CAGGAAAACAACCTCAGTGTAGG + Intergenic
1032138796 7:129307689-129307711 CAGCAAATTCACGACTGTGTTGG - Intronic
1033170046 7:139076098-139076120 AAGGAAAACCACAGCTGGGTGGG - Intronic
1035723980 8:1813536-1813558 CACCCAAAACACGCCTGTGTAGG - Intergenic
1038207365 8:25479414-25479436 AAGAAAAGCCACGCCTGTTTGGG + Intronic
1041630727 8:60083709-60083731 CCTGAAAAGCAGGCCTGTGTGGG - Intergenic
1044270838 8:90241367-90241389 CAGGAAAATCATGCCTGTTATGG + Intergenic
1051000888 9:12280404-12280426 CAGGCAAACCATACCTGTGGTGG + Intergenic
1054884180 9:70178056-70178078 AAGGAAAACCACTCTTTTGTGGG - Intronic
1056129656 9:83571487-83571509 CAGGAAGAGCAAGCCTGTGAAGG + Intergenic
1057131974 9:92660479-92660501 CAGGAAAGCAAGGCCTGTCTCGG + Intronic
1057429320 9:94979827-94979849 CAGCAAACCAACTCCTGTGTTGG - Intronic
1057916013 9:99055758-99055780 TAGGAAAACCACACCTATCTAGG - Intronic
1058704741 9:107628911-107628933 CAGGAAAACCATGAGTCTGTGGG - Intergenic
1192419623 X:71017680-71017702 TAGGAGAACTAAGCCTGTGTGGG - Intergenic
1196723750 X:118878015-118878037 CAGGATGACCACGTCTCTGTGGG + Intergenic
1198112592 X:133514773-133514795 CAGGGAAGCAAAGCCTGTGTTGG + Intergenic
1201368829 Y:13238157-13238179 CAGGAAAACCCAGCCTGAGCAGG + Intergenic