ID: 1168076627

View in Genome Browser
Species Human (GRCh38)
Location 19:53983803-53983825
Sequence GCAGGAAGGAGCTTGCAGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168076627 Original CRISPR GCAGGAAGGAGCTTGCAGCG AGG Exonic