ID: 1168078499

View in Genome Browser
Species Human (GRCh38)
Location 19:53992964-53992986
Sequence GGGGCTGACGCCCGAGCGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168078484_1168078499 28 Left 1168078484 19:53992913-53992935 CCGGCGGCGGGGGGCCGCGGGCC 0: 1
1: 0
2: 4
3: 40
4: 422
Right 1168078499 19:53992964-53992986 GGGGCTGACGCCCGAGCGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 117
1168078492_1168078499 7 Left 1168078492 19:53992934-53992956 CCGGCGGCGGGCGCACGGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1168078499 19:53992964-53992986 GGGGCTGACGCCCGAGCGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 117
1168078489_1168078499 14 Left 1168078489 19:53992927-53992949 CCGCGGGCCGGCGGCGGGCGCAC 0: 1
1: 0
2: 2
3: 33
4: 282
Right 1168078499 19:53992964-53992986 GGGGCTGACGCCCGAGCGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168078499 Original CRISPR GGGGCTGACGCCCGAGCGCG AGG Exonic
900126834 1:1072465-1072487 GGGGCTGCCGGCCGAGCTGGGGG + Exonic
900190056 1:1349418-1349440 CGGGGGGGCGCCCGAGCGCGCGG + Intergenic
900192008 1:1355912-1355934 GGGGCAGACCCCCGAGGGCCTGG + Intronic
901660708 1:10796314-10796336 AGGGCTGGCACCCGGGCGCGGGG - Intronic
904488671 1:30844551-30844573 GGGGCTGATGCCCGGGAGGGAGG + Intergenic
904696938 1:32336124-32336146 GGGGCTGGCGCCCGAGGGGGAGG + Exonic
908272884 1:62437421-62437443 GGGGCCGGCTCCCGGGCGCGGGG + Intronic
908355617 1:63323106-63323128 GGTGCTGACGGCCGAGGACGTGG + Exonic
908951412 1:69567489-69567511 GGGGCTGGCCCGCGAGCGGGAGG + Intergenic
913450405 1:118988986-118989008 GGGGCGGGCGGCGGAGCGCGGGG + Intronic
919638707 1:200029240-200029262 GGGGCTCGCGCCCGCGCGGGCGG + Intronic
921738259 1:218653448-218653470 GGGGCTGAAGCCAGGGAGCGAGG + Intergenic
1073074912 10:100817717-100817739 GGGGCTGAGGCCAGAGCCTGGGG + Intronic
1076057634 10:127388714-127388736 GGGGCAGAAGCCCCAGGGCGGGG - Intronic
1077074936 11:696048-696070 GGGCCAGGCGCCCGCGCGCGGGG - Intronic
1078003146 11:7513709-7513731 GGGGCTGGGGCCCGGACGCGCGG + Intronic
1079246899 11:18759119-18759141 GGACCTGACGCCCGAGCCCCAGG + Intronic
1080012377 11:27472143-27472165 GGGGCTGACGGCCGTGCCCGAGG - Exonic
1083758424 11:64803255-64803277 GGGGCTGAGGCCCGGGGGCGGGG + Intergenic
1083912544 11:65718705-65718727 GGGGCTGAAGTCGGAGAGCGGGG + Exonic
1084330003 11:68424651-68424673 AGGGCTGAAGCCCGAGATCGAGG + Intronic
1084710309 11:70840041-70840063 GGGGCTGAAGGCAGAGGGCGTGG + Intronic
1084979418 11:72821459-72821481 AGGGCTGACTCCAGAGCCCGAGG + Intronic
1087154033 11:94883841-94883863 GGGGCTGAAGCTAGAGAGCGAGG + Intergenic
1091393255 12:138719-138741 GGGGCGGGCGCCGGAGAGCGCGG + Exonic
1092270429 12:7018874-7018896 GGGGGGGCCGCCCGCGCGCGAGG + Intronic
1092861832 12:12725263-12725285 GGGGCCGCGGCCGGAGCGCGGGG - Intergenic
1094025703 12:25958536-25958558 GCGGCTGAAACCCGAGCGCCCGG + Intergenic
1096241339 12:49961818-49961840 GGGGCGGGCGGCCGGGCGCGGGG - Intergenic
1100329262 12:93570103-93570125 AGGGCTGACGCCCCAGGGCTGGG - Intronic
1101466911 12:104958332-104958354 GGGGCTGCCGCGCGGGGGCGGGG - Intronic
1101880588 12:108623116-108623138 GGGCCTGACGCCAGAGCCCAGGG - Exonic
1113082786 13:106535399-106535421 CGGGCAGCGGCCCGAGCGCGCGG + Intergenic
1120953530 14:90062328-90062350 GGAGCTGGCGCACGAGCGCCAGG + Exonic
1122267100 14:100551840-100551862 GGGTCTGATGCCCCAGCGCATGG + Intronic
1125589401 15:40844860-40844882 GGAGCTGCAGCCCGACCGCGGGG + Exonic
1128766329 15:70253249-70253271 GGGGCTGCCGCCCCAAAGCGAGG + Intergenic
1132573133 16:652697-652719 GGGGCAGATGCCTGAGCACGCGG - Intronic
1132638115 16:963282-963304 GGGGCTGAGGGCCTACCGCGAGG - Intronic
1132698213 16:1211306-1211328 GGGGCAGACCCCCGGGCACGTGG - Intronic
1136141647 16:28292559-28292581 GGGGCCGGGGCCCGAGCGCCAGG + Exonic
1136412322 16:30084669-30084691 GGGGCTCACGCCCCAGCCTGTGG - Exonic
1137412984 16:48244906-48244928 GAGGCTGAAGACCGAGGGCGAGG - Intronic
1141609219 16:85171609-85171631 GGGGCTGAAGTCCGTGCGGGTGG + Exonic
1142596226 17:1031376-1031398 GGGGCAGATGCCCGAGCGCCAGG + Intronic
1144959699 17:19038288-19038310 GGGGTAGACGCCCCAGCGCCTGG + Intronic
1144975461 17:19136236-19136258 GGGGTAGACGCCCCAGCGCCTGG - Intronic
1146167414 17:30600757-30600779 GGGGCTGAGGCCCGAGCTGCCGG - Intergenic
1146219820 17:31008653-31008675 GGGGCTGAGGCCCGAGCTTTTGG - Intergenic
1148337646 17:46852032-46852054 GGGACTGACGCCTGAACGGGCGG - Intronic
1148397791 17:47324013-47324035 GGGGCTGACCACAGAGAGCGCGG + Exonic
1151729840 17:75904752-75904774 GGGGCTGTCGCCCGAGCTGTGGG - Intronic
1152321492 17:79610670-79610692 GGGGCTGACCCGAGGGCGCGTGG - Intergenic
1152433419 17:80261407-80261429 GGCGAAGTCGCCCGAGCGCGGGG + Intronic
1153636376 18:7117241-7117263 GGGGCTGTTGGCCGGGCGCGGGG - Intronic
1156036522 18:32771784-32771806 GGGGCTGTCGAACGAGCGGGGGG + Intronic
1161100165 19:2417765-2417787 GGGGCTGCCGCCCTAGCACCTGG - Intronic
1161289116 19:3483376-3483398 GGGGCTGGCGGCCGAGGGGGAGG - Intergenic
1161494989 19:4581664-4581686 GGAGCCGACGCCAGCGCGCGGGG - Intergenic
1161732454 19:5969710-5969732 GGGGCTGAAGCCCGAGGCCATGG - Intronic
1161779207 19:6279918-6279940 GGGGCTGGCGGGCGAGCGGGCGG - Exonic
1162372898 19:10289726-10289748 GGGGATGACGCGAGAGAGCGTGG + Intergenic
1162733774 19:12734537-12734559 GGGGACGTCGCCCGAGAGCGGGG - Exonic
1165348124 19:35261782-35261804 GGGGCTGAAGCCCTAGTGCATGG - Intronic
1167153757 19:47725587-47725609 GGGGCTGGGGCCAGAGCGAGGGG + Intronic
1167463406 19:49638187-49638209 GGGGCTGGGGCCCGAGGGTGGGG - Intronic
1167781431 19:51601504-51601526 GGGGCAGGCGCCGGGGCGCGGGG - Intergenic
1168078499 19:53992964-53992986 GGGGCTGACGCCCGAGCGCGAGG + Exonic
947542834 2:230990580-230990602 GGAGCTGTCGCCCCAGCGCTTGG - Intergenic
948523925 2:238558986-238559008 GGGGCTGGCGCCTGAGTGCCAGG + Intergenic
1174216764 20:48921852-48921874 GGGGCTGACGGCCCCGCGGGCGG - Intergenic
1174658758 20:52192524-52192546 AGGGCTGACGCAGGAGCCCGGGG - Intronic
1175191782 20:57216509-57216531 GGGGCTGTCTCCTGAGGGCGAGG + Intronic
1175191789 20:57216531-57216553 GGGGCTGTCTCCTGAGGGCGAGG + Intronic
1175429313 20:58891108-58891130 CGGGCTGCTGCCCGAGCCCGGGG + Intronic
1176157137 20:63627454-63627476 GGGGCGGACGCCTGAACACGAGG + Intergenic
1178104142 21:29299289-29299311 CGGGCTGGCGCCCGAGGGCAGGG - Intronic
1180876833 22:19178633-19178655 GCGGCGGCCGCCAGAGCGCGCGG + Exonic
1181653040 22:24271345-24271367 GGGGCTGCCGCCCCATCGCCCGG + Intronic
1184067729 22:42129822-42129844 TGGGCTGGCGGCCGTGCGCGAGG - Exonic
1184070464 22:42143494-42143516 TGGGCTGGCGGCCGTGCGCGAGG - Intergenic
1185039589 22:48497499-48497521 GGGGCTGAGGCCTGGGGGCGGGG + Intronic
1185039610 22:48497557-48497579 GGGGCTGAGGCCTGGGGGCGGGG + Intronic
1185039653 22:48497674-48497696 GGGGCTGAGGCCTGGGGGCGGGG + Intronic
1185039696 22:48497791-48497813 GGGGCTGAGGCCTGGGGGCGGGG + Intronic
950260073 3:11537093-11537115 GGGGCTGACAGCAGAGCACGTGG - Intronic
950710661 3:14810887-14810909 GGCGCCGAGGCACGAGCGCGAGG + Intergenic
954664730 3:52245789-52245811 GGGGCTGCCCGCGGAGCGCGGGG - Intronic
959091835 3:101911423-101911445 GGGGCTGAAGCCAGAGAGCCAGG - Intergenic
961182389 3:124887059-124887081 GGGGCTGGGGCCGGAGCGCGGGG + Exonic
961665121 3:128489612-128489634 GGGGCGGGAGGCCGAGCGCGAGG + Intronic
963028422 3:140942297-140942319 GGGGGTGAGGCCCGGGCCCGAGG + Intronic
966919377 3:184602044-184602066 GGGGCTGGGGCCCGCGGGCGGGG + Intronic
968085489 3:195872161-195872183 GGGGCTGAAGCCCGGGCGAAAGG + Intronic
968946009 4:3664658-3664680 GGGCCTGACTCCCGGGCACGTGG + Intergenic
968958475 4:3730694-3730716 GGGGCTGGGGCCCCAGGGCGGGG + Intergenic
969413369 4:7043516-7043538 GGCGCTGACGGCCGGGGGCGCGG + Exonic
985706894 5:1406537-1406559 GGGGCTGTTGCCGGGGCGCGGGG - Intronic
985751918 5:1685278-1685300 GGGGCTCACGCCTGAGTGGGTGG - Intergenic
997129667 5:131264127-131264149 GGGGCTGCGGCCGGAGCGGGCGG + Exonic
1006169395 6:32084504-32084526 GGTGATGACGGCCGAGCGCTGGG + Intronic
1007783083 6:44265212-44265234 GGGGCTGCCGTCCGAGGGCCCGG + Exonic
1014632521 6:123803860-123803882 GGGCCAGATGCCCGAGGGCGCGG + Intergenic
1015776832 6:136822864-136822886 GGGGCTTTCCCTCGAGCGCGAGG - Intronic
1019170080 6:170128914-170128936 GGGGCTGAGGCCCCTGCACGTGG - Intergenic
1022106341 7:27200152-27200174 GGGGCCGGGGCCCGAGCGAGGGG + Intergenic
1025258270 7:57399731-57399753 GGGCCTGACGCCCCAGCTCAGGG - Intergenic
1025610365 7:63071999-63072021 GGGCCTGACGCCCCAGCTCAGGG + Intergenic
1029483722 7:100827217-100827239 GGGCCCGCCGCCCGCGCGCGCGG - Exonic
1037801280 8:22037213-22037235 GGGGCTGGCCCCCTAGGGCGAGG - Intergenic
1049613641 8:143567211-143567233 GGGGCTGGGGCCCGAGGGCCAGG - Exonic
1049620941 8:143598014-143598036 GGGGCCGCGGCCCGGGCGCGGGG - Exonic
1049651557 8:143772060-143772082 GCTGCTGACGCGCGAGGGCGTGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049850383 8:144827344-144827366 GGGGCTGGCGCCTGGGGGCGGGG - Intergenic
1060514575 9:124257916-124257938 GGGGCGGGCGCGCGGGCGCGCGG + Intronic
1061262580 9:129488374-129488396 GCGGCTGCCTCCGGAGCGCGGGG + Intergenic
1062556161 9:137114266-137114288 GGAGCTGGCGGCCGAGCGGGGGG - Exonic
1062732211 9:138116439-138116461 GGGGCTGACTCCCGAGCCGCTGG + Intronic
1203793805 EBV:165516-165538 GTGGCTCATGCCCGAGGGCGTGG + Intergenic
1185504798 X:624228-624250 GGGGCTGGCGCGCGCGCGCGAGG + Intergenic
1187394393 X:18907034-18907056 GGGCCTGCCGCCCGAGCCCCGGG - Exonic
1199772452 X:150983625-150983647 GGGGCCGACCCCCGAAAGCGGGG - Intronic
1200177170 X:154125438-154125460 GGGGCTGAGGCTGGGGCGCGGGG - Intergenic