ID: 1168078884

View in Genome Browser
Species Human (GRCh38)
Location 19:53994806-53994828
Sequence TACCCACTTGGTGTCCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168078878_1168078884 -6 Left 1168078878 19:53994789-53994811 CCCCCGGCTGTCTGAGCTACCCA 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1168078879_1168078884 -7 Left 1168078879 19:53994790-53994812 CCCCGGCTGTCTGAGCTACCCAC 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1168078876_1168078884 0 Left 1168078876 19:53994783-53994805 CCAGGCCCCCCGGCTGTCTGAGC 0: 1
1: 0
2: 1
3: 18
4: 221
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1168078880_1168078884 -8 Left 1168078880 19:53994791-53994813 CCCGGCTGTCTGAGCTACCCACT 0: 1
1: 0
2: 1
3: 10
4: 174
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1168078877_1168078884 -5 Left 1168078877 19:53994788-53994810 CCCCCCGGCTGTCTGAGCTACCC 0: 1
1: 0
2: 2
3: 7
4: 105
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1168078873_1168078884 21 Left 1168078873 19:53994762-53994784 CCTCGATAGGACAGTGGGATGCC 0: 1
1: 0
2: 1
3: 0
4: 27
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1168078872_1168078884 22 Left 1168078872 19:53994761-53994783 CCCTCGATAGGACAGTGGGATGC 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1168078868_1168078884 28 Left 1168078868 19:53994755-53994777 CCCAAGCCCTCGATAGGACAGTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1168078881_1168078884 -9 Left 1168078881 19:53994792-53994814 CCGGCTGTCTGAGCTACCCACTT 0: 1
1: 0
2: 1
3: 12
4: 168
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95
1168078869_1168078884 27 Left 1168078869 19:53994756-53994778 CCAAGCCCTCGATAGGACAGTGG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168078884 Original CRISPR TACCCACTTGGTGTCCAGAT GGG Intronic
900815892 1:4845503-4845525 TACCCACATGGTACCCAGAATGG + Intergenic
902622606 1:17659232-17659254 TACTCTCTGGGTGTCCAGTTTGG + Intronic
910224806 1:84925488-84925510 TAACCACTTGGTCTCCAAAAGGG - Intergenic
910638973 1:89439829-89439851 AACCCAATTTGTGGCCAGATAGG + Intergenic
914325355 1:146609665-146609687 TACCAACTTGGTGTAGAGAAAGG - Intergenic
921771831 1:219049599-219049621 TACCAAATTGGTGTCCACTTTGG + Intergenic
922968797 1:229716789-229716811 TACACATTTGCTGTCCGGATGGG - Intergenic
924150198 1:241122273-241122295 TACACACTAGGCATCCAGATTGG - Intronic
1070198368 10:74179881-74179903 AACCCTCTTGGGGTCTAGATCGG + Intronic
1071907195 10:90187406-90187428 TAGCCACTGGAGGTCCAGATAGG + Intergenic
1072155825 10:92722911-92722933 TAGTCAGTTGGTGTCCAGCTGGG - Intergenic
1073194400 10:101676688-101676710 GAACCACTGGATGTCCAGATTGG + Intronic
1073288187 10:102400808-102400830 TCCCACCTTGGTGACCAGATGGG - Exonic
1079489249 11:20969120-20969142 TGCTCACTTGGAGACCAGATAGG + Intronic
1090221603 11:125031477-125031499 TACCCACTTTATGGCTAGATGGG + Intronic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1091833162 12:3564711-3564733 TAGTGACTTGGGGTCCAGATTGG + Intronic
1092582029 12:9852179-9852201 GACCTACTTGGTGTCAAGCTGGG - Intergenic
1093036352 12:14335803-14335825 TACCCACTTTATGTCTAGATGGG - Intergenic
1098535093 12:71585082-71585104 AACCCACTTGCTTTCCAAATGGG + Exonic
1099887923 12:88554936-88554958 GACCAACTTGGAGTCCAAATTGG + Intronic
1101291218 12:103371685-103371707 TGCACACATGCTGTCCAGATGGG - Intronic
1106603483 13:31207131-31207153 TACCCCCTTAGTGTGCAGATGGG - Intronic
1107545024 13:41427174-41427196 TACCCACTTGGTATTAGGATCGG - Intergenic
1109580325 13:64322938-64322960 TACCCACTTAGTAGCCAGCTTGG + Intergenic
1112454999 13:99551986-99552008 TACCCAATTGCTCTTCAGATTGG - Intronic
1115695306 14:35891267-35891289 TTCGCACTTGTTGCCCAGATTGG + Intronic
1116379556 14:44248257-44248279 TACCCACTGGGAGCTCAGATGGG - Intergenic
1118880758 14:69823901-69823923 GACCCACTTTATGTCTAGATGGG + Intergenic
1118904281 14:70012188-70012210 TTCTCACTTGGAGTCCTGATAGG - Intronic
1119829818 14:77692111-77692133 TACCAACTTTGTGTCCCGTTTGG - Intronic
1121530234 14:94647563-94647585 TACCCACTGTGTGTCTAGACTGG - Intergenic
1126684994 15:51240777-51240799 TTCCCACTTTCTGTCCAGCTGGG + Intronic
1130151437 15:81314688-81314710 TTTCCCCTTGTTGTCCAGATTGG - Intronic
1130532884 15:84760991-84761013 TTCCCTCTTGTTGCCCAGATTGG + Intronic
1132463767 16:68289-68311 CACCCACTTGAGGCCCAGATGGG - Intronic
1134639721 16:15820442-15820464 TTCCCTCTTGGTGCCCAGGTTGG - Intronic
1135646248 16:24164753-24164775 TATCGACTTGAAGTCCAGATTGG - Intronic
1139402731 16:66695884-66695906 TTCCCACTTGATGTCTAGCTGGG - Intronic
1140008206 16:71101282-71101304 TACCAACTTGGTGTAGAGAAAGG + Intronic
1141244938 16:82297156-82297178 TGCCCACTTGCTCTCCAGAGAGG + Intergenic
1146836371 17:36114120-36114142 GACCCACTTTGTGGCTAGATGGG - Intergenic
1148371228 17:47101154-47101176 TTCCCTCTTGTTGCCCAGATTGG - Intergenic
1157525226 18:48375356-48375378 TTCCCACTGTGTGTCCAGCTTGG - Intronic
1159602065 18:70437594-70437616 TACCCAATTGTTCTCCAGAGTGG + Intergenic
1163654884 19:18539808-18539830 TGCCCACTAGCTGTCCAGAGGGG + Intronic
1168078884 19:53994806-53994828 TACCCACTTGGTGTCCAGATGGG + Intronic
926513894 2:13816774-13816796 CACACACTTGGTATCCATATAGG - Intergenic
927741287 2:25571888-25571910 TACCCTCCTTGTGGCCAGATGGG + Intronic
932316630 2:70788833-70788855 TACCCAATTGCTTTCTAGATAGG - Intronic
935070727 2:99691423-99691445 TCCCCGCTTGGTGTCCAAACTGG + Intronic
935183949 2:100715017-100715039 GACCCACTTTATGACCAGATGGG - Intergenic
937469906 2:122165944-122165966 CACTCACTGGGTGTCCAAATCGG + Intergenic
938103039 2:128511433-128511455 TTCTCACCTGGTCTCCAGATAGG + Intergenic
941234448 2:162952543-162952565 TACCCACCAAGTGTCCAGATTGG - Intergenic
1168750003 20:275685-275707 TACCCACTTGGTTGACACATGGG + Intronic
1168788871 20:562738-562760 TCCCCACAGGGTGTCCAGGTAGG + Intergenic
1173528559 20:43751154-43751176 TACACAGTTGGTGTCAATATTGG + Intergenic
1178000601 21:28158402-28158424 TACCCACTTGGTATCCACTGAGG - Intergenic
1179017083 21:37603300-37603322 TGCCCACTTGATGGCCAGCTGGG + Intergenic
1184445238 22:44543207-44543229 TGCCCACGTGGGGTCCAGGTGGG - Intergenic
949170027 3:986486-986508 GACCCACTTTATGGCCAGATGGG + Intergenic
951113618 3:18834331-18834353 TACACACCTGGCTTCCAGATAGG - Intergenic
952904631 3:38131707-38131729 TCCCCACCTGGTCTCTAGATGGG + Intronic
954826529 3:53378278-53378300 GTCTCACTTGTTGTCCAGATGGG + Intergenic
957468772 3:80631054-80631076 TACCCACTTGATGCCAAGATTGG - Intergenic
958708553 3:97688762-97688784 TACCCACTTTGTTTCTAAATGGG + Intronic
958839338 3:99184969-99184991 TACCCAGTTGGTATCCAATTTGG + Intergenic
963254475 3:143130999-143131021 TGCCCACATTGTGTGCAGATTGG - Intergenic
972805929 4:42529444-42529466 GACCCACTTGATGGCTAGATGGG - Intronic
977466014 4:97383491-97383513 GACCCACTTAATGTCTAGATGGG - Intronic
980861845 4:138508598-138508620 TATCCACTTGGTGTCTAAAGAGG - Intergenic
982803528 4:159734240-159734262 TACCTACTTGGTGTTCAGTTTGG + Intergenic
986284520 5:6349508-6349530 CACCCACTTGTTTTCCAGCTTGG - Intergenic
986578119 5:9233781-9233803 TGCCCACTTGCTGTTCTGATGGG - Intronic
988281431 5:29152383-29152405 TACCCACTCCTTGTCCAGTTAGG + Intergenic
993700309 5:91111470-91111492 TTCCCACTTAGTATCCAGAAGGG + Intronic
998619114 5:143774799-143774821 TTCCAACATGGTGTCCAGAATGG + Intergenic
1000144260 5:158438041-158438063 CACCAAATTGGTGTCCAGATTGG + Intergenic
1003942771 6:11044675-11044697 TACCCACCCGCTGCCCAGATCGG + Intergenic
1006990458 6:38210927-38210949 GACCCACTTGGTGTTCAGGAGGG - Intronic
1022473972 7:30698466-30698488 CTCCCACTTGTTTTCCAGATAGG - Intronic
1024013109 7:45287528-45287550 CACCCAGTTGGTGTCCAGAGAGG - Intergenic
1028272009 7:88803339-88803361 TACCAACTAGGAGTCAAGATAGG + Intronic
1029629417 7:101741117-101741139 TACCCACTTGGCTTCCTGTTAGG + Intergenic
1041641118 8:60202849-60202871 TACCCTCTTGGAGTTCACATAGG + Intronic
1041925775 8:63234721-63234743 GACCCACTTGGTTTCCAAACTGG + Intergenic
1042360660 8:67878973-67878995 TACCCACTTGGAGGACAGTTTGG + Intergenic
1046096887 8:109573193-109573215 TACCCAGTAGGTGTCTATATAGG + Intergenic
1049373736 8:142279522-142279544 TGCCCACCGGGTGTCCAGATGGG - Intronic
1051749273 9:20324605-20324627 TACCGACTTTGGGTTCAGATTGG - Intergenic
1053162854 9:35825561-35825583 TGCCTAGTTGGTGTCCAGGTTGG + Exonic
1053475052 9:38376610-38376632 TGCCCACTTGGAATCCAGAGGGG - Intergenic
1053490754 9:38499847-38499869 TTCCCACTCAGTGTCCAGAAGGG - Intergenic
1053519625 9:38764583-38764605 ACCCCACTTGGTGTCCACCTAGG + Intergenic
1057302449 9:93894709-93894731 CACCCACTTGGTTTCTAAATTGG + Intergenic
1059950837 9:119461056-119461078 TACCCACATGTTATGCAGATGGG - Intergenic
1061286813 9:129628236-129628258 TTGCCTCGTGGTGTCCAGATTGG - Intronic
1061659611 9:132120181-132120203 TACCCTCTTACTGTCCAGGTAGG + Intergenic
1186943531 X:14539539-14539561 TACTCACTTGGAGTCTAGTTTGG + Intronic
1189154869 X:38746605-38746627 GACCCACTTTGTGGCTAGATGGG + Intergenic
1198701315 X:139400411-139400433 GACCCACTTTATGTCTAGATGGG - Intergenic
1199024392 X:142919834-142919856 GACCCACTTTGTGGCTAGATGGG - Intergenic