ID: 1168081299

View in Genome Browser
Species Human (GRCh38)
Location 19:54012342-54012364
Sequence ACGTATTTACAGAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168081299_1168081304 0 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081304 19:54012365-54012387 TTTTCTCTGTGGCTGTATGTGGG 0: 1
1: 0
2: 3
3: 34
4: 399
1168081299_1168081308 11 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081308 19:54012376-54012398 GCTGTATGTGGGTTGCTTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 156
1168081299_1168081305 8 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081305 19:54012373-54012395 GTGGCTGTATGTGGGTTGCTTGG 0: 1
1: 0
2: 2
3: 25
4: 203
1168081299_1168081312 20 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081312 19:54012385-54012407 GGGTTGCTTGGGGGTGGGATGGG 0: 1
1: 1
2: 8
3: 72
4: 583
1168081299_1168081313 26 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081313 19:54012391-54012413 CTTGGGGGTGGGATGGGAAGAGG 0: 1
1: 2
2: 9
3: 148
4: 1134
1168081299_1168081310 15 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081310 19:54012380-54012402 TATGTGGGTTGCTTGGGGGTGGG 0: 1
1: 0
2: 4
3: 24
4: 313
1168081299_1168081311 19 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081311 19:54012384-54012406 TGGGTTGCTTGGGGGTGGGATGG 0: 1
1: 0
2: 12
3: 62
4: 646
1168081299_1168081306 9 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081306 19:54012374-54012396 TGGCTGTATGTGGGTTGCTTGGG 0: 1
1: 0
2: 2
3: 13
4: 143
1168081299_1168081307 10 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081307 19:54012375-54012397 GGCTGTATGTGGGTTGCTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 182
1168081299_1168081303 -1 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081303 19:54012364-54012386 TTTTTCTCTGTGGCTGTATGTGG 0: 1
1: 0
2: 1
3: 43
4: 447
1168081299_1168081309 14 Left 1168081299 19:54012342-54012364 CCTTTCTCCCTCTGTAAATACGT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1168081309 19:54012379-54012401 GTATGTGGGTTGCTTGGGGGTGG 0: 1
1: 0
2: 3
3: 24
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168081299 Original CRISPR ACGTATTTACAGAGGGAGAA AGG (reversed) Exonic
903387365 1:22936326-22936348 ATCTGTTTACAGAGGGACAAAGG - Intergenic
906103196 1:43276233-43276255 GCAGCTTTACAGAGGGAGAACGG - Intergenic
908813728 1:68010594-68010616 ACGTATTTATTGAGGGAAAAAGG - Intergenic
913456705 1:119039453-119039475 ACATATACACAGAGAGAGAAAGG + Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917423944 1:174893961-174893983 ATGTAATTACAGAGGAAAAAAGG - Intronic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919381227 1:196863870-196863892 ACGTATTCAAATAGGAAGAAAGG - Intronic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
920819106 1:209363733-209363755 ACTTCCTTACAGAGGTAGAAAGG + Intergenic
1065146197 10:22770862-22770884 AATTATTTTCAGAGGGAGAGAGG + Intergenic
1065598329 10:27340286-27340308 AAGTATTTACAGAGGCAAAAGGG + Intergenic
1065804086 10:29378878-29378900 ACTTATTTGCATTGGGAGAAAGG + Intergenic
1069699524 10:70411822-70411844 AAGTATATACATTGGGAGAAGGG - Intronic
1071189210 10:83080750-83080772 ATCTATTTAAAAAGGGAGAAAGG + Intergenic
1071380255 10:85052396-85052418 ATGTTTTTACAAAGGGAGATTGG + Intergenic
1071837371 10:89431929-89431951 AAGAATTAACACAGGGAGAAAGG + Exonic
1073363242 10:102917417-102917439 CCATATTTACAGAGTGGGAAGGG - Intergenic
1074718188 10:116240003-116240025 AGCAATTCACAGAGGGAGAAAGG + Intronic
1075135786 10:119784900-119784922 AAATATTTACAGAGACAGAAAGG - Intronic
1076664066 10:132076200-132076222 GCGAATTTACAGAGGAAGAAGGG - Intergenic
1078612658 11:12835092-12835114 AGGAAGTTACAGAGGGAGATTGG + Intronic
1079442486 11:20529156-20529178 ACGTAGTTAGAGAGGAAAAAGGG + Intergenic
1080532230 11:33188199-33188221 ACTTATTTTCAGAGATAGAAAGG - Intergenic
1082664601 11:55959873-55959895 ACATATTTACAAATGGAAAAAGG + Intergenic
1082716498 11:56620268-56620290 AAGTATATACAATGGGAGAAAGG - Intergenic
1082955531 11:58866164-58866186 AAGCTTTTACAGAGGAAGAAAGG - Intronic
1082999870 11:59281430-59281452 ACTTAGTTCCAGAGGGAGGAAGG + Intergenic
1084227359 11:67725548-67725570 TCCTATTTTCAGAGGGAGAGAGG + Intergenic
1084807834 11:71591299-71591321 TCCTATTTTCAGAGGGAGAGAGG - Intronic
1084844951 11:71891318-71891340 TCCTATTTTCAGAGGGAGAGAGG - Intronic
1084847715 11:71913282-71913304 TCCTATTTTCAGAGGGAGAGAGG - Intronic
1086820407 11:91429573-91429595 AGGTATTCACATAGGGAGAGAGG - Intergenic
1086911671 11:92479573-92479595 CCTTATCTACAGAGGCAGAATGG - Intronic
1088992096 11:114962542-114962564 CTGTCTTTACTGAGGGAGAAGGG - Intergenic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1091689516 12:2586003-2586025 AGGTACTTACAGAGGGACACTGG - Intronic
1093282172 12:17208235-17208257 ACGTATTAACATAGAGACAATGG - Intergenic
1094045183 12:26159175-26159197 ACAGATTGACAGAGGGTGAAGGG + Intronic
1094097020 12:26717897-26717919 ACGTGTTTTCCTAGGGAGAATGG - Intronic
1094811709 12:34144619-34144641 AGGTATTTAAATAGGAAGAAAGG + Intergenic
1096893624 12:54797351-54797373 ACCTCCTTATAGAGGGAGAAGGG - Intergenic
1099913661 12:88864768-88864790 ACTTCTTTACAGAGAAAGAATGG - Intergenic
1103823950 12:123721019-123721041 ACTGGTTTACAGAGGGAGAGAGG - Intronic
1105391335 13:19981632-19981654 TCGTATTTACAGGAGGAAAAAGG - Intronic
1107949640 13:45450507-45450529 AAATATTTACAGAAGGAGAGTGG + Intergenic
1108183593 13:47866331-47866353 AGGTAAATAAAGAGGGAGAAAGG - Intergenic
1108200261 13:48036504-48036526 GCATATTAACAGAGGGAGAAAGG - Intergenic
1111233865 13:85382284-85382306 ATTAATTTAGAGAGGGAGAAAGG - Intergenic
1111257275 13:85686860-85686882 AAGGATCTTCAGAGGGAGAAAGG + Intergenic
1111280657 13:86018943-86018965 ATGAAATGACAGAGGGAGAAAGG + Intergenic
1113360777 13:109629380-109629402 ACGTAATCACAGGGGGAGAAAGG + Intergenic
1113739800 13:112703593-112703615 ACGTAATTACTTAGTGAGAATGG + Intronic
1113942590 13:114026113-114026135 ACGTCTTTACAGAGTGAAACAGG + Intronic
1114983583 14:28196033-28196055 ACCTGTTTACAGAGGTTGAAAGG - Intergenic
1115485407 14:33906161-33906183 ACATATTTATATAGAGAGAATGG + Intergenic
1116182966 14:41558513-41558535 ACATATATACAGAGGAATAAAGG + Intergenic
1116360843 14:43996099-43996121 TCGGGTTCACAGAGGGAGAAAGG + Intergenic
1116927158 14:50651365-50651387 GGGTATTTACAGGGGGAGGAAGG + Intronic
1118135099 14:63015472-63015494 ACGTACATACAGAGAGAGAAAGG - Intronic
1121029296 14:90644500-90644522 AAGTGTTTACTCAGGGAGAAGGG - Intronic
1121821000 14:96966014-96966036 ACGTATGGACAGCGGGTGAAGGG + Intergenic
1126045001 15:44631373-44631395 CCGTATTTACAGAGTGTCAAAGG + Intronic
1127976386 15:64000336-64000358 ACGTATTTGTTCAGGGAGAAAGG - Intronic
1130832994 15:87620792-87620814 CCCTATTTTGAGAGGGAGAAAGG + Intergenic
1131465597 15:92652796-92652818 AAGGAGTTGCAGAGGGAGAAAGG + Intronic
1136243989 16:28962825-28962847 ACGTGATGACAGAGGCAGAATGG - Intronic
1136855469 16:33652870-33652892 ACGTATTCAAATAGGAAGAAAGG + Intergenic
1203117055 16_KI270728v1_random:1501351-1501373 ACGTATTCAAATAGGAAGAAAGG + Intergenic
1146560503 17:33864845-33864867 ATTTATTTACAGAGACAGAAAGG - Intronic
1150902622 17:69298406-69298428 AGGTATTTTGAGAGGGAAAAGGG - Intronic
1152333631 17:79687279-79687301 ACGCATTTGCAGAGGGAAAAGGG + Intergenic
1154329507 18:13418146-13418168 AGGAAGCTACAGAGGGAGAAAGG - Intronic
1157028800 18:43879613-43879635 CCCTATTTGCAGAGGAAGAAAGG - Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1161576204 19:5055780-5055802 ACCTATTTAAAGAGAGAGAAAGG - Intronic
1163253900 19:16143385-16143407 ACATCATTACAAAGGGAGAACGG - Intronic
1166590345 19:43992239-43992261 ACGTAGTCAGAGAGGCAGAATGG - Intronic
1168081299 19:54012342-54012364 ACGTATTTACAGAGGGAGAAAGG - Exonic
929243923 2:39681803-39681825 CAGTTTTTACAAAGGGAGAAAGG + Intronic
932505731 2:72229526-72229548 AGGTATTATCAGAGGGAGACAGG + Intronic
934604804 2:95686655-95686677 AAATATTTGCAGAGGGAGTATGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
940635983 2:156297371-156297393 ACCTATTTTCACATGGAGAAAGG - Intergenic
941244649 2:163081162-163081184 AAGTTTTTACAGAGAGAGAATGG - Intergenic
941689853 2:168489276-168489298 ACATTATTACAGAGGAAGAATGG - Intronic
942497459 2:176554502-176554524 CCGTACCTAGAGAGGGAGAATGG + Intergenic
943350331 2:186789477-186789499 GGGTATTTAAATAGGGAGAAAGG + Intergenic
943420615 2:187663442-187663464 AAGTATTTAGTGAAGGAGAAGGG + Intergenic
943477093 2:188370144-188370166 TCGTATCTTCAGAGGGGGAAAGG + Intronic
948737474 2:240018361-240018383 ACCTATTTCAGGAGGGAGAAAGG + Intronic
1169712713 20:8582471-8582493 ACGTAGTTACAGCTGGAGACTGG - Intronic
1172032020 20:31989029-31989051 ATGGATTCACAGTGGGAGAATGG + Intronic
1172409647 20:34711636-34711658 AGGTATTTACTGGAGGAGAAGGG - Exonic
1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG + Intergenic
1175680725 20:60986574-60986596 TCCAATTTACGGAGGGAGAAGGG + Intergenic
1178672816 21:34606771-34606793 ACGTAGGGACACAGGGAGAAGGG + Intronic
950720712 3:14880725-14880747 ACGTATCTGCAGAGGGAAAGAGG - Exonic
952014466 3:28940521-28940543 CAGTGTTTACAGAGGAAGAAGGG - Intergenic
952988908 3:38813844-38813866 ACGTATTTGCTTAGTGAGAAGGG + Intergenic
954042326 3:47898170-47898192 ACGCTTTTACAGAGGGGGAAGGG + Intronic
959525678 3:107373621-107373643 TCATATTGAAAGAGGGAGAAAGG + Intergenic
959635365 3:108561196-108561218 AAGTATGTACTGAGTGAGAAAGG - Intronic
959664022 3:108901782-108901804 AAGTATTTAGAGAGGCAGAATGG - Intergenic
960051841 3:113246803-113246825 AGGTATCCAGAGAGGGAGAAAGG - Intronic
961217624 3:125172694-125172716 ACTTCTTTCCAGAGGGAGATTGG - Intronic
961275445 3:125722387-125722409 TCCTATTTCCAGAGGGAGAGAGG - Intergenic
962611434 3:137080246-137080268 ACATATATACAGAGATAGAATGG - Intergenic
964526212 3:157617292-157617314 AGGTAATTACAGAGGGTGAGTGG + Intronic
966610041 3:181858947-181858969 AGGTATTTTCAGAGTGAGAGAGG - Intergenic
967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG + Intergenic
968354413 3:198093171-198093193 ACTTATTAACAGTGTGAGAATGG - Intergenic
968988402 4:3892393-3892415 TCCTATTTTCAGAGGGAGAGAGG + Intergenic
969024015 4:4159497-4159519 TCCTATTTTCAGAGGGAGAGAGG + Intergenic
969024992 4:4165984-4166006 TCCTATTTTCAGAGGGAGAGAGG + Intergenic
970343381 4:15130055-15130077 GTGTATTTACTGAGAGAGAAAGG - Intergenic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
976132911 4:81904012-81904034 ACGTAGTCACAGAGAGAGACTGG - Intronic
976986831 4:91311112-91311134 ATGTATTTACAGAAGAAGATAGG + Intronic
978449835 4:108820044-108820066 ACATATTTTCAGAGTGACAATGG + Intronic
979710702 4:123775935-123775957 ATATATTTGCAGAGTGAGAATGG - Intergenic
980784380 4:137533058-137533080 AAGTATTTACAGAGGGAGTGGGG - Intergenic
981639822 4:146928186-146928208 GAGTATTTTCAGAGGCAGAATGG + Intronic
984196093 4:176659915-176659937 AAGAATTTTCAGAGGGAGCATGG - Intergenic
985118459 4:186615739-186615761 AGCTATTTCCAAAGGGAGAAGGG - Intronic
987204244 5:15608917-15608939 ACCCATTTACAGAAGGTGAAAGG + Intronic
987593167 5:19959664-19959686 ACAGATTTCCAGAAGGAGAAGGG + Intronic
992553819 5:77884416-77884438 CTGTATATACAGAGTGAGAAAGG + Intergenic
994012972 5:94929158-94929180 ATGTACCTACAGAGGAAGAAAGG - Intronic
996216403 5:120871860-120871882 ATGGATTTATAGAGGAAGAAAGG - Intergenic
996671430 5:126122252-126122274 ACTTTTTTTCAGTGGGAGAATGG + Intergenic
998674512 5:144391996-144392018 GTGAATTTACAGAGGAAGAAAGG + Intronic
1001701466 5:173709749-173709771 CCCCATTGACAGAGGGAGAAAGG - Intergenic
1004329875 6:14711594-14711616 ACAAATTTACTGAGGGAGCAGGG + Intergenic
1005532973 6:26726631-26726653 ACATATTTACAGATTGAAAAAGG + Intergenic
1005537821 6:26775033-26775055 ACATATTTACAGATTGAAAAAGG - Intergenic
1005792337 6:29316794-29316816 ACATGTTTACAGAGAGAGATAGG + Intergenic
1007050435 6:38822929-38822951 GGGAATTTACAGAGGAAGAAAGG - Exonic
1007080201 6:39095414-39095436 AAATATTTACCGAGAGAGAAAGG + Intergenic
1009008691 6:57817441-57817463 ACATATTTACAGATTGAAAAAGG - Intergenic
1010301749 6:74268494-74268516 AAGTATATATAGATGGAGAAAGG + Intergenic
1011754876 6:90488199-90488221 GAGTATTTACAGAGAGAAAAAGG - Intergenic
1013724489 6:113076848-113076870 AGGTATCTACAGAGGGATGAAGG + Intergenic
1013964000 6:115934069-115934091 ATATATTTAGAGAGAGAGAAAGG + Exonic
1014385559 6:120797664-120797686 GCGTATTTAAATAGGAAGAAAGG - Intergenic
1016205549 6:141464009-141464031 CAGTACTTACAGAGGTAGAAAGG - Intergenic
1016422263 6:143897802-143897824 ACAGAGTTACAGAGGGAGATGGG - Intronic
1017065144 6:150521912-150521934 ATGTATATACAGAGGGGAAAAGG - Intergenic
1020311135 7:6869739-6869761 TCCTATTTTCAGAGGGAGAGAGG + Intergenic
1021296809 7:18918236-18918258 CCATGTTTGCAGAGGGAGAATGG + Intronic
1021959019 7:25853962-25853984 CGGTATTTGCAGAGGGAGACGGG - Intergenic
1022975019 7:35548835-35548857 ACGTGTTTTCAGAGGAGGAATGG - Intergenic
1023957406 7:44897896-44897918 AAGTATTAACAGTTGGAGAATGG + Intergenic
1027622351 7:80505034-80505056 AAGAATTTACAGAGGGATCAGGG + Intronic
1028055642 7:86238777-86238799 GCATATTTAGAGAGAGAGAAAGG - Intergenic
1028579118 7:92386871-92386893 AAGTATTTACAGAGGTAGGCTGG - Intronic
1031424773 7:121592216-121592238 ACTTCTTTATGGAGGGAGAAAGG + Intergenic
1031915907 7:127562912-127562934 ACTTGTTTATAGAGTGAGAATGG - Intergenic
1032478465 7:132228000-132228022 ATGCATGTACAGAGAGAGAAAGG - Intronic
1044879001 8:96702772-96702794 ACTTGTTTACAGAAGGAGAAAGG - Intronic
1045721203 8:105112776-105112798 ACGTGTTTAGGGAGGGAGAATGG + Intronic
1045766770 8:105681709-105681731 ACTTATTTACAGGGGGAAAAAGG - Intronic
1045941193 8:107740071-107740093 ATCTATCTACAAAGGGAGAATGG + Intergenic
1046552423 8:115733444-115733466 ATTTATATACAGAGAGAGAAGGG - Intronic
1048923007 8:139247578-139247600 GTGTCTGTACAGAGGGAGAAAGG + Intergenic
1052470229 9:28884570-28884592 AATTATTTACAGATGGACAAAGG - Intergenic
1052678235 9:31654702-31654724 AAACATTTACAAAGGGAGAAAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055296752 9:74841095-74841117 AAGTGTTTTCAGAGGGATAATGG - Intronic
1057045454 9:91882789-91882811 ACGTGAAAACAGAGGGAGAAAGG + Intronic
1061375513 9:130222152-130222174 ATGTATATACAGAGAGAGAGAGG + Intronic
1192497828 X:71628046-71628068 ACGTATTCCCAGAGACAGAAGGG - Intergenic
1193197481 X:78650706-78650728 ACTATTTTACAGAGGAAGAATGG - Intergenic
1194004360 X:88472026-88472048 ACAAATTTACAGAGGAAAAAGGG + Intergenic
1196533928 X:116818334-116818356 AAGTGTTTTCAGAGGGATAATGG + Intergenic
1198442694 X:136679346-136679368 ACATATTTGCAGATGGACAATGG + Intronic
1201339239 Y:12914763-12914785 ACTTATTTTCAGTGGGTGAAAGG - Intronic