ID: 1168083155

View in Genome Browser
Species Human (GRCh38)
Location 19:54025129-54025151
Sequence CTCTATCAGCCGAAGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168083153_1168083155 29 Left 1168083153 19:54025077-54025099 CCTGGATAATTTTTAGTTTATTT No data
Right 1168083155 19:54025129-54025151 CTCTATCAGCCGAAGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168083155 Original CRISPR CTCTATCAGCCGAAGCAGTC AGG Intergenic
No off target data available for this crispr