ID: 1168084409

View in Genome Browser
Species Human (GRCh38)
Location 19:54034815-54034837
Sequence GCCCCAACTCGGAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168084409_1168084421 23 Left 1168084409 19:54034815-54034837 CCCTGCCCCTTCCGAGTTGGGGC No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data
1168084409_1168084417 -10 Left 1168084409 19:54034815-54034837 CCCTGCCCCTTCCGAGTTGGGGC No data
Right 1168084417 19:54034828-54034850 GAGTTGGGGCGGGAGCTCCCAGG 0: 4
1: 19
2: 39
3: 69
4: 305
1168084409_1168084418 -9 Left 1168084409 19:54034815-54034837 CCCTGCCCCTTCCGAGTTGGGGC No data
Right 1168084418 19:54034829-54034851 AGTTGGGGCGGGAGCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168084409 Original CRISPR GCCCCAACTCGGAAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr