ID: 1168084410

View in Genome Browser
Species Human (GRCh38)
Location 19:54034816-54034838
Sequence CGCCCCAACTCGGAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168084410_1168084418 -10 Left 1168084410 19:54034816-54034838 CCTGCCCCTTCCGAGTTGGGGCG No data
Right 1168084418 19:54034829-54034851 AGTTGGGGCGGGAGCTCCCAGGG No data
1168084410_1168084421 22 Left 1168084410 19:54034816-54034838 CCTGCCCCTTCCGAGTTGGGGCG No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168084410 Original CRISPR CGCCCCAACTCGGAAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr