ID: 1168084416

View in Genome Browser
Species Human (GRCh38)
Location 19:54034826-54034848
Sequence TGGGAGCTCCCGCCCCAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168084416_1168084421 12 Left 1168084416 19:54034826-54034848 CCGAGTTGGGGCGGGAGCTCCCA No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168084416 Original CRISPR TGGGAGCTCCCGCCCCAACT CGG (reversed) Intergenic