ID: 1168084418

View in Genome Browser
Species Human (GRCh38)
Location 19:54034829-54034851
Sequence AGTTGGGGCGGGAGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168084410_1168084418 -10 Left 1168084410 19:54034816-54034838 CCTGCCCCTTCCGAGTTGGGGCG No data
Right 1168084418 19:54034829-54034851 AGTTGGGGCGGGAGCTCCCAGGG No data
1168084398_1168084418 29 Left 1168084398 19:54034777-54034799 CCCAGCCCGGGCTATACACGCTA No data
Right 1168084418 19:54034829-54034851 AGTTGGGGCGGGAGCTCCCAGGG No data
1168084402_1168084418 23 Left 1168084402 19:54034783-54034805 CCGGGCTATACACGCTATGGAGC No data
Right 1168084418 19:54034829-54034851 AGTTGGGGCGGGAGCTCCCAGGG No data
1168084405_1168084418 1 Left 1168084405 19:54034805-54034827 CCGCAGGGAGCCCTGCCCCTTCC No data
Right 1168084418 19:54034829-54034851 AGTTGGGGCGGGAGCTCCCAGGG No data
1168084399_1168084418 28 Left 1168084399 19:54034778-54034800 CCAGCCCGGGCTATACACGCTAT No data
Right 1168084418 19:54034829-54034851 AGTTGGGGCGGGAGCTCCCAGGG No data
1168084409_1168084418 -9 Left 1168084409 19:54034815-54034837 CCCTGCCCCTTCCGAGTTGGGGC No data
Right 1168084418 19:54034829-54034851 AGTTGGGGCGGGAGCTCCCAGGG No data
1168084401_1168084418 24 Left 1168084401 19:54034782-54034804 CCCGGGCTATACACGCTATGGAG No data
Right 1168084418 19:54034829-54034851 AGTTGGGGCGGGAGCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168084418 Original CRISPR AGTTGGGGCGGGAGCTCCCA GGG Intergenic
No off target data available for this crispr