ID: 1168084419

View in Genome Browser
Species Human (GRCh38)
Location 19:54034845-54034867
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168084419_1168084421 -7 Left 1168084419 19:54034845-54034867 CCCAGGGTGATGCTACAGCTGTC No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168084419 Original CRISPR GACAGCTGTAGCATCACCCT GGG (reversed) Intergenic
No off target data available for this crispr