ID: 1168084421

View in Genome Browser
Species Human (GRCh38)
Location 19:54034861-54034883
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168084416_1168084421 12 Left 1168084416 19:54034826-54034848 CCGAGTTGGGGCGGGAGCTCCCA No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data
1168084415_1168084421 16 Left 1168084415 19:54034822-54034844 CCTTCCGAGTTGGGGCGGGAGCT No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data
1168084409_1168084421 23 Left 1168084409 19:54034815-54034837 CCCTGCCCCTTCCGAGTTGGGGC No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data
1168084420_1168084421 -8 Left 1168084420 19:54034846-54034868 CCAGGGTGATGCTACAGCTGTCC No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data
1168084413_1168084421 18 Left 1168084413 19:54034820-54034842 CCCCTTCCGAGTTGGGGCGGGAG No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data
1168084414_1168084421 17 Left 1168084414 19:54034821-54034843 CCCTTCCGAGTTGGGGCGGGAGC No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data
1168084419_1168084421 -7 Left 1168084419 19:54034845-54034867 CCCAGGGTGATGCTACAGCTGTC No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data
1168084410_1168084421 22 Left 1168084410 19:54034816-54034838 CCTGCCCCTTCCGAGTTGGGGCG No data
Right 1168084421 19:54034861-54034883 AGCTGTCCAAACCCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168084421 Original CRISPR AGCTGTCCAAACCCCAGCTG TGG Intergenic