ID: 1168086651

View in Genome Browser
Species Human (GRCh38)
Location 19:54052517-54052539
Sequence CTCAGAAAGACAAATTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 13, 3: 66, 4: 407}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168086651_1168086654 26 Left 1168086651 19:54052517-54052539 CCTGCAGAATTTGTCTTTCTGAG 0: 1
1: 0
2: 13
3: 66
4: 407
Right 1168086654 19:54052566-54052588 TATGCGGAGATGTTGATGAAAGG 0: 1
1: 0
2: 1
3: 74
4: 561
1168086651_1168086653 10 Left 1168086651 19:54052517-54052539 CCTGCAGAATTTGTCTTTCTGAG 0: 1
1: 0
2: 13
3: 66
4: 407
Right 1168086653 19:54052550-54052572 TTTGTTTAGCATGATATATGCGG 0: 1
1: 0
2: 3
3: 25
4: 263
1168086651_1168086655 27 Left 1168086651 19:54052517-54052539 CCTGCAGAATTTGTCTTTCTGAG 0: 1
1: 0
2: 13
3: 66
4: 407
Right 1168086655 19:54052567-54052589 ATGCGGAGATGTTGATGAAAGGG 0: 1
1: 1
2: 41
3: 281
4: 835

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168086651 Original CRISPR CTCAGAAAGACAAATTCTGC AGG (reversed) Intronic
900198609 1:1391204-1391226 CTCAGAAAGAAAATGTCTACTGG + Intronic
900676900 1:3892696-3892718 CAGAGAAAGACACACTCTGCAGG - Intronic
903137502 1:21318966-21318988 CCCAGGAAGCCAAATTCTGTGGG + Intronic
906911030 1:49950981-49951003 CATAGAAAGACAAATACTGCAGG + Intronic
908269427 1:62408757-62408779 TTCACAAAGACAAATAATGCAGG + Intergenic
908629888 1:66091877-66091899 TTCACAAAGACAAATTATACTGG + Intronic
909050787 1:70765799-70765821 CCCAGAAAGGCAAACTCTCCTGG + Intergenic
909620675 1:77663334-77663356 CTCAGAAAAAAAAAGTCTGGTGG + Intronic
910166241 1:84330169-84330191 CCTAGAAAGGCAAATTCTCCAGG - Intronic
910299605 1:85691023-85691045 CTCAAAAAAACAAGTTCTGCTGG + Intronic
911119288 1:94279218-94279240 CACAGAAATACTAATGCTGCTGG - Intergenic
911313362 1:96325164-96325186 TACAGAAAGACAAATACTGCAGG + Intergenic
912112144 1:106356645-106356667 CTCAGGGAGAGAAATTCTGATGG + Intergenic
913648676 1:120888065-120888087 CTCAGAAAGACAAACACTGAAGG + Intergenic
914078019 1:144375298-144375320 CTCGGAAAGACAAAGACTGAAGG - Intergenic
914101160 1:144591203-144591225 CTCGGAAAGACAAAGACTGAAGG + Intergenic
914172928 1:145243833-145243855 CTCGGAAAGACAAAGACTGAAGG - Intergenic
914297816 1:146346443-146346465 CTCGGAAAGACAAAGACTGAAGG - Intergenic
914527581 1:148484969-148484991 CTCAGAAAGACAAAGACTGAAGG - Intergenic
914638812 1:149582093-149582115 CTCGGAAAGACAAAGACTGAAGG + Intergenic
914906275 1:151748160-151748182 CACAGAAAGAAAAATCCTCCAGG - Intergenic
916061966 1:161105410-161105432 CTAAGGAAAATAAATTCTGCTGG - Intronic
916919450 1:169448384-169448406 CTCAGAAAAACAAAAACTGAAGG - Intronic
916927468 1:169538230-169538252 CACAGAAAGACAAGTACTGCAGG + Intronic
918944393 1:191043150-191043172 CACCGAAAGACAAATACTGTAGG + Intergenic
919067002 1:192704901-192704923 CACAGAAAGACAAATGTTACAGG - Intergenic
919491972 1:198215109-198215131 CTCAGACACACAAATGCTGAAGG + Intronic
921838067 1:219798749-219798771 CACATAAAGATAAATTCTTCAGG + Intronic
922404749 1:225300390-225300412 CTCAGAAAAAAATATTCTGATGG + Intronic
922439236 1:225638598-225638620 CTGAGAAAGTAAAATTGTGCAGG + Intronic
923699999 1:236291117-236291139 CTCAGAGATACACATTCTTCAGG + Intergenic
923869854 1:237979865-237979887 TTCAGAATGACAAATGCTTCAGG + Intergenic
924733558 1:246734088-246734110 CTCAGAAAGCCTGATTCTGGGGG + Intronic
1063235884 10:4115867-4115889 TTCTGAAAGAAAAATTCTCCAGG - Intergenic
1063519937 10:6732141-6732163 CACAGAAAGACAAATACCACAGG - Intergenic
1064431611 10:15275932-15275954 CTCAGAGAGGAAAATACTGCAGG + Exonic
1064579682 10:16781351-16781373 CCCCAAAAGAAAAATTCTGCTGG - Intronic
1064947295 10:20805197-20805219 CTCAGAAAGGAGATTTCTGCAGG + Intronic
1065377019 10:25053528-25053550 CACAGAAAGACAAATAGGGCAGG - Intronic
1067687202 10:48473236-48473258 CACAAAAAGACAAATACTACAGG + Intronic
1068164556 10:53312069-53312091 TTCAGACAGTAAAATTCTGCTGG - Intergenic
1068182703 10:53543116-53543138 CACAGAAAGACAAATACCACAGG - Intergenic
1068547215 10:58360942-58360964 CTCAGAAAGAATAATACTTCAGG - Intronic
1069052104 10:63806027-63806049 CACAGAAAGACAAACATTGCAGG - Intergenic
1069861962 10:71477117-71477139 CTCAGACACACAACATCTGCAGG - Intronic
1070406511 10:76102477-76102499 AACAGAAAGCCAAATACTGCAGG - Intronic
1070804641 10:79263948-79263970 CTCAGAAAAGTAAATTATGCAGG + Intronic
1072102578 10:92243380-92243402 CTCACAAATACAGATTCTGAGGG + Intronic
1072951418 10:99849762-99849784 CTCTGTAAGAAAATTTCTGCAGG - Intronic
1073343944 10:102767838-102767860 ATCAGAAAGAAAAACTGTGCTGG + Intronic
1074413989 10:113251146-113251168 CTCAGAAACAGAAAAACTGCTGG - Intergenic
1074860318 10:117505052-117505074 CTGAGAAAGCAAAATTCCGCTGG - Intergenic
1075168768 10:120093621-120093643 CAGAAAAAGACAAATACTGCAGG - Intergenic
1076112204 10:127869379-127869401 CTCAGACAAGCAAATTCTGAGGG - Intergenic
1078369458 11:10733040-10733062 CTTGGAAAGTCAAACTCTGCTGG - Intergenic
1078906348 11:15691715-15691737 ATGGGAAACACAAATTCTGCAGG - Intergenic
1079603399 11:22338652-22338674 CTCAGCATGAAAAAATCTGCAGG + Intronic
1079606979 11:22382070-22382092 CTCAGAAAGCCTCATGCTGCAGG + Intergenic
1080588083 11:33699445-33699467 ATGGGAAAGACAAAGTCTGCAGG + Intronic
1080598022 11:33792977-33792999 TTCAGAAAGAAAAAGTCTGGAGG + Intergenic
1082131353 11:48493344-48493366 CACAGAAAGGCAAATATTGCAGG + Intergenic
1082564849 11:54664218-54664240 CACAGAAAGGCAAATATTGCAGG + Intergenic
1082660510 11:55904071-55904093 CACAGAAAGACAAATTGCTCAGG + Intergenic
1082850717 11:57761962-57761984 CTGAGAAAGACAAATCCAGCAGG - Exonic
1082898871 11:58223988-58224010 CACAGAAAGACAAATACTGCAGG + Intergenic
1082950521 11:58810231-58810253 CTCAGAAAGACAAATGCTTCAGG - Intergenic
1082962497 11:58932692-58932714 CACAGAAGAACAAATTCAGCTGG + Intronic
1083753028 11:64772716-64772738 CTCAGAAAAATAAATTGTGTGGG - Intronic
1084676057 11:70635459-70635481 CACAAAAAGATAAATACTGCAGG + Intronic
1085097252 11:73771412-73771434 CTCTGAAAGAAAAAATATGCCGG - Intergenic
1085290447 11:75395452-75395474 TTCAGAAAACCAAATTCTGGAGG - Intergenic
1086982990 11:93219053-93219075 CACAGAAAAACAATTTCAGCAGG + Intergenic
1087306532 11:96496055-96496077 CTCAGAAATACAAGTTCATCAGG + Intronic
1087458916 11:98422052-98422074 CTCAGACAAACAAACTCTGGTGG - Intergenic
1087977788 11:104571240-104571262 CTCAGAAACACAAATCCTCCAGG - Intergenic
1088925428 11:114296467-114296489 CTCAGGAAGACAACTTCTGCAGG + Exonic
1090283050 11:125474332-125474354 CTCAAAAAGAAAAATTAGGCCGG - Intronic
1090619524 11:128548934-128548956 CTCTGAAATAAAAAATCTGCTGG + Intronic
1090973188 11:131660298-131660320 GTCTGAAAGACAGATGCTGCAGG + Intronic
1091611024 12:2009575-2009597 CTCAGAATCACAAATTCTTAGGG - Intronic
1091638785 12:2218359-2218381 TTCAGGAAGAAAATTTCTGCTGG + Intronic
1092142764 12:6195240-6195262 CTCAAAAAAAAAAAATCTGCAGG + Intergenic
1093510918 12:19927272-19927294 CATAGAAGGACAAATACTGCAGG - Intergenic
1094590485 12:31814905-31814927 CTCAGAAAAAAAAGTTCAGCTGG + Intergenic
1095101141 12:38184822-38184844 CACAGAAAGAGAGACTCTGCTGG + Intergenic
1095328582 12:40928962-40928984 CACATAAAGACAATTTCTACTGG - Intronic
1095501502 12:42845046-42845068 CTCAGACAAACAAAATCTGAAGG - Intergenic
1095502196 12:42852294-42852316 CACAGAAAGACAAATACCACAGG + Intergenic
1097509084 12:60513731-60513753 CACAGAAAGACAAAGATTGCAGG + Intergenic
1097596526 12:61639481-61639503 AGCAGAAAGTCAAATACTGCAGG - Intergenic
1097624921 12:61988444-61988466 TATAGAAAGACAAACTCTGCTGG + Intronic
1097770432 12:63578209-63578231 TACAGAAAGACAAACTTTGCAGG + Intronic
1098011679 12:66059875-66059897 GGCAGAAAAACAAATGCTGCTGG + Intergenic
1098289061 12:68937599-68937621 CTTGGAAAGACAAATTGTTCAGG + Intronic
1099381817 12:81963946-81963968 CTGAGAAAGACAATTTAAGCAGG + Intergenic
1100252486 12:92842084-92842106 CACAAAAAGACAAATACTGTTGG + Intronic
1100402165 12:94241605-94241627 CACAGAAAGACAAATATTGCAGG - Intronic
1101205967 12:102487440-102487462 CTTGGAAAGTCAAAGTCTGCAGG + Intergenic
1102865955 12:116374084-116374106 CTCCGAAAGACAACTGCTCCAGG + Intergenic
1103466144 12:121143391-121143413 CTCAGAAAAACAAATTAACCAGG + Intronic
1103674793 12:122647190-122647212 CTCAGAAAGGTACATTCTTCTGG + Intergenic
1103736760 12:123065542-123065564 GTCAAAAAGACATAATCTGCTGG - Intronic
1103995296 12:124825789-124825811 GACAGAAGGACAAATACTGCAGG + Intronic
1104502393 12:129298724-129298746 CACAGAAAGACAAATACCGCAGG - Intronic
1105390854 13:19976654-19976676 CACAAAAAGACAAATACTGCAGG - Intronic
1106755469 13:32818956-32818978 CCCAGAAAGACAAATATTGCAGG + Intergenic
1107275014 13:38668239-38668261 CATAGAAAGACAAATCCTGCAGG + Intergenic
1109031384 13:57194271-57194293 CACAGCAAGACAAACTTTGCAGG - Intergenic
1109072308 13:57785754-57785776 TTCAGAAAAACAAATGCTGAGGG - Intergenic
1109152244 13:58859738-58859760 CTGAGAAATGCAAATTCGGCAGG - Intergenic
1109335989 13:60994386-60994408 CACAGTAAGACAAATACTGCAGG - Intergenic
1109400341 13:61819537-61819559 CTCAGAAACAGAAAATCTGCAGG + Intergenic
1109807634 13:67465228-67465250 CACAGAGAGACAAATACTGGAGG - Intergenic
1109842137 13:67932702-67932724 CTTGGAAAGAAAAATTCTTCAGG + Intergenic
1111211289 13:85083373-85083395 ATCAGAGAGACAACTTGTGCAGG + Intergenic
1111641828 13:90979161-90979183 TTCAGACAAACAAATTCTGAGGG + Intergenic
1113845950 13:113391682-113391704 CACAGAAGGACAAATTCTGTGGG - Intergenic
1114045608 14:18873039-18873061 ATCAGCAACACAAACTCTGCGGG + Intergenic
1114118603 14:19646429-19646451 ATCAGCAACACAAACTCTGCGGG - Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1114964996 14:27946759-27946781 CTCAGAAAGAAAAATCTTTCAGG + Intergenic
1115166237 14:30451695-30451717 CTCAAAAAGACAAATTAGGCAGG + Intergenic
1115554280 14:34532148-34532170 CGCATTAAGAAAAATTCTGCAGG + Intronic
1116096443 14:40376464-40376486 CACAGAAAGAGAAATACTGTTGG - Intergenic
1116140684 14:40990493-40990515 CTCAGAAAGACAAAAGCTAAGGG - Intergenic
1116935403 14:50734450-50734472 CACAAAAAGACAATTTCTACAGG + Intronic
1117029450 14:51652690-51652712 TCCAGAAACCCAAATTCTGCAGG - Intronic
1117711921 14:58539116-58539138 CACAGAAAGACAAACTTTGAAGG - Intronic
1118014618 14:61646923-61646945 CACAGAGACAAAAATTCTGCAGG + Intronic
1118558445 14:67051894-67051916 TTCAGAAAAACAAATACTGAGGG + Intronic
1121487929 14:94332859-94332881 GTCAGAAAGACAAATACTTCAGG - Intergenic
1122005729 14:98702004-98702026 AACAGAAAGTCAAATACTGCAGG - Intergenic
1122546469 14:102525446-102525468 CACAAAAAGACAAATACTGTAGG + Intergenic
1123191206 14:106573590-106573612 TTCAGAAAAACAAATGCTGAGGG - Intergenic
1124057885 15:26259399-26259421 CACAGAAAGACAAATACTGCAGG + Intergenic
1124184248 15:27509024-27509046 CTCAGAAAAACAAAAACTGAGGG - Intronic
1124791771 15:32734146-32734168 CTCAGGAAGACATGTTCAGCTGG - Exonic
1126288310 15:47042163-47042185 CACAGGATGACAAATGCTGCAGG - Intergenic
1127188916 15:56508725-56508747 CTCAGAAAAGCAAATGCTGAGGG + Intergenic
1127745459 15:61966382-61966404 ATCAGAATGACAAACTCTGAAGG + Intronic
1127818773 15:62637059-62637081 CTCAGGAAGGCATATTCTGCAGG - Intronic
1130894457 15:88159460-88159482 CTTAGAAAAGCAAATTCTCCAGG - Intronic
1131600974 15:93848479-93848501 TTCAGAAAGGCAAAGTCTCCTGG + Intergenic
1132127404 15:99240211-99240233 CCCAGAATAACAAATACTGCAGG - Intronic
1132145807 15:99429075-99429097 CACAGAAAGACAAATACCGCAGG + Intergenic
1133655624 16:7860970-7860992 CTAAAATAGTCAAATTCTGCTGG + Intergenic
1134220827 16:12352669-12352691 TTCAGAACCACAACTTCTGCTGG + Intronic
1134448947 16:14351773-14351795 CACAGAAAGACAAATACCGCAGG - Intergenic
1135034227 16:19063254-19063276 CTTAAAAAAATAAATTCTGCTGG + Intronic
1135069835 16:19342136-19342158 CTCATATAAAAAAATTCTGCAGG - Intergenic
1137538701 16:49347319-49347341 CTGAGAAAGAGAAGTTCTCCTGG - Intergenic
1137684577 16:50377350-50377372 CACAGAAAGAGAAATACTGCAGG - Intergenic
1138986643 16:62337177-62337199 CTAATAAAATCAAATTCTGCTGG - Intergenic
1139674954 16:68517326-68517348 ATCAGAAAGGCACATTTTGCTGG - Intergenic
1140158579 16:72459941-72459963 CACAGTAAGTCAAACTCTGCAGG - Intergenic
1140646319 16:77034787-77034809 CACAGAAAGACAAACTTTGCAGG - Intergenic
1141494699 16:84399999-84400021 CACAGAAAGGCAAACTTTGCAGG - Intronic
1141908790 16:87044672-87044694 CTTAGAAAGAAAAAGGCTGCTGG - Intergenic
1142909572 17:3076546-3076568 CAAAGAAAGACAAAAACTGCAGG - Intergenic
1142924926 17:3227268-3227290 CAAAGAAAGACAAAAACTGCAGG + Intergenic
1144566423 17:16363209-16363231 CTCAAAAACAAAAATTCAGCTGG - Intergenic
1144573396 17:16414944-16414966 CTCAGAAAGACAAATTTTGGAGG + Intergenic
1145081745 17:19900045-19900067 CTCAGAAAAAAAAAATATGCTGG - Intergenic
1145085725 17:19937935-19937957 CTCAGAAATTCTGATTCTGCAGG - Intronic
1146377407 17:32303876-32303898 GGCAGAAAGCCAAATTCTGCAGG - Intronic
1146382243 17:32339699-32339721 AGAATAAAGACAAATTCTGCAGG + Intronic
1147265027 17:39229422-39229444 CTCTGAAACACAAAGGCTGCAGG - Intergenic
1147504692 17:41004141-41004163 ATCAGAAAGTGTAATTCTGCTGG + Intergenic
1147973113 17:44230513-44230535 CTCAGAAAGTTAAAAACTGCAGG - Intergenic
1148588250 17:48796323-48796345 CTAAGAAACTCCAATTCTGCTGG + Intronic
1148755131 17:49969318-49969340 CTCAGAGAGACACTTTCTCCGGG + Exonic
1149400313 17:56289290-56289312 CTCAGAAAGAGCTATTTTGCTGG + Intronic
1149976164 17:61268554-61268576 CCCAGAAAGACAATTACTGGTGG - Intronic
1150064785 17:62099885-62099907 GTCAGAAATTCAAATTCAGCCGG - Intergenic
1153683685 18:7524656-7524678 CTGAGAAAGGCAAATAATGCAGG - Intergenic
1154155137 18:11938206-11938228 CTAGGAAAGACAAAATCTGGAGG + Intergenic
1156088542 18:33438926-33438948 CTAGGAAAGACAATTTCTGGGGG - Intronic
1156556254 18:38071488-38071510 CTCAGACAGACAAATGCCTCTGG - Intergenic
1157310839 18:46551949-46551971 CACAAAAAGACAAATTCTGTAGG + Intronic
1157986367 18:52442839-52442861 GTCAGAAAGCCAATGTCTGCAGG + Intronic
1158352768 18:56579751-56579773 CTCAGACAGACAAAAACTGAGGG + Intergenic
1159056402 18:63469146-63469168 CTCAGAAACACAAAGTCAGCTGG - Intergenic
1159478471 18:68956057-68956079 CACAGAAAGACAAACTTTGCAGG - Intronic
1159821044 18:73143806-73143828 AACAGAAAGACAAATACTGTAGG - Intergenic
1160036500 18:75306253-75306275 CACAAAAAGACAAATACTGTAGG - Intergenic
1160167650 18:76528484-76528506 CCCATAAAGTCAAATTATGCGGG + Intergenic
1160181593 18:76641504-76641526 CACAGAAAGACAAGTACTGCAGG - Intergenic
1160595445 18:79970532-79970554 CTCAGAAAGACGAATCCTGTTGG - Exonic
1160882337 19:1326843-1326865 CTCAAAAAGGCAGATTCGGCCGG + Intergenic
1161652370 19:5493144-5493166 TTCAGAAAAACAAATTCATCTGG + Intergenic
1162207184 19:9064893-9064915 CTCAGAAAGACCAAGTCCGCAGG + Intergenic
1165984993 19:39760438-39760460 CACAGAAGGACAAATACTGCAGG + Intergenic
1168086651 19:54052517-54052539 CTCAGAAAGACAAATTCTGCAGG - Intronic
1168514447 19:57000062-57000084 CTCATAAAGACACATCCTGAGGG - Intergenic
1168521713 19:57056438-57056460 AACAGAAAGTCAAATACTGCAGG + Intergenic
925038348 2:709435-709457 CACAAAAAGACAAACGCTGCAGG - Intergenic
927033994 2:19152659-19152681 CACAGAAAGACAAATATTTCAGG - Intergenic
927824077 2:26295298-26295320 CACAAAAGGACAAATTCTGTAGG + Intergenic
928488182 2:31754094-31754116 CCCAGAAAGACAAATGCAGAAGG + Intergenic
928655814 2:33450467-33450489 CACAGAAAGACAAGTTCTGCAGG - Intronic
931255004 2:60563236-60563258 CTCTGAGAGACTAATTCTGGAGG + Intergenic
931316055 2:61133254-61133276 CTCAAAAAAAAAAATTCTTCAGG + Intronic
933025413 2:77251848-77251870 CTCAGGAAGACAAATTCCTGGGG - Intronic
933341463 2:81031817-81031839 CTCAGACAAACAAAATCTGACGG - Intergenic
933444379 2:82359879-82359901 CACAGAAAGACAAATACTGCAGG - Intergenic
933577950 2:84091561-84091583 CTCAGATAAACAAAATCTACAGG + Intergenic
933604088 2:84362702-84362724 CTCAGATAAACAAATGCTGAAGG + Intergenic
933654897 2:84879547-84879569 CTCATAAAGACAGATTCTAAAGG + Intronic
933690987 2:85179405-85179427 CTTAGAAATACAAATTCTCAGGG - Intronic
934123185 2:88860030-88860052 CTCAAAAAGACACATTCTATAGG - Intergenic
934760625 2:96854199-96854221 CTTAAAAAGAGAAATTTTGCTGG + Intronic
935219882 2:101002982-101003004 GTCAGAAAGACCAATGCAGCTGG - Intronic
935657044 2:105432112-105432134 CTCAGAAGGAAAATCTCTGCAGG - Intronic
936554355 2:113480439-113480461 TTAAGAAAGGCAAATTTTGCTGG - Intronic
938177332 2:129145525-129145547 CACAGAAAGACAAATACTGCAGG - Intergenic
938226594 2:129621908-129621930 TGCAGAAAAACAAATACTGCAGG + Intergenic
938269614 2:129958019-129958041 ATCAGCAACACAAACTCTGCGGG - Intergenic
939360592 2:141166979-141167001 TTCAGAAACACTAATTCTGTAGG + Intronic
940215749 2:151301715-151301737 CACAGAAAGACAAATATTGCAGG + Intergenic
940410777 2:153360767-153360789 CTTAGAAAGACTAAGTCTGCTGG - Intergenic
940506713 2:154564836-154564858 CTCAGAAAAACAAAAGCTGAGGG - Intergenic
940825807 2:158410904-158410926 CTCAGATAGACAAAAACTGAAGG - Intronic
941687846 2:168465629-168465651 CACAAAAAGACAAATACTGTAGG + Intronic
942001330 2:171650943-171650965 CTCAGAAAAACAAAAGCTGAGGG - Intergenic
942053176 2:172159646-172159668 CACAGAAAGAAAAATATTGCAGG - Intergenic
942139827 2:172966958-172966980 ATCAGGAAGACGATTTCTGCAGG + Intronic
942593589 2:177571339-177571361 CACTTAAAGACAACTTCTGCTGG - Intergenic
942977151 2:182031493-182031515 GTCATAAATACAAATTCTCCAGG - Intronic
943092143 2:183388413-183388435 CTCAGAAAAGCAAATGCTGAGGG - Intergenic
943963802 2:194303885-194303907 CTCAAAAAAAAAAAATCTGCTGG - Intergenic
944415167 2:199472680-199472702 CTAAGAACGACAAAATATGCGGG - Intergenic
944751102 2:202710804-202710826 CAGAGAAAGACAAACTTTGCAGG - Intronic
946143985 2:217714846-217714868 CTCTTAAAGACAAAGGCTGCTGG - Intronic
946398977 2:219458810-219458832 TTCAGAAAATCTAATTCTGCAGG + Intronic
946480010 2:220046071-220046093 CTGAGATAGAGAAATTTTGCAGG + Intergenic
946988206 2:225298716-225298738 CTGAGGAAGATAAATTCTGATGG - Intergenic
946992423 2:225350323-225350345 CGCAGAATGAGAAATTCTGATGG - Intergenic
947066389 2:226230660-226230682 CACAGAAAGACAAACACTGGAGG + Intergenic
947883531 2:233543688-233543710 CTCACAGACACAAAATCTGCTGG + Intronic
948077857 2:235180289-235180311 CACAGAAAACCAAATACTGCAGG - Intergenic
1169162702 20:3395578-3395600 CTCTGAAAGACAAAATGTTCAGG - Intronic
1169223209 20:3839102-3839124 CACAGAAAGACATATCCTTCTGG + Intergenic
1169975279 20:11318839-11318861 CAAAGAAGGACAAATACTGCAGG + Intergenic
1169988934 20:11476833-11476855 CTCAGAGAAACAAAAGCTGCGGG + Intergenic
1170238760 20:14138498-14138520 CACATAAGGACAAATACTGCAGG + Intronic
1170947247 20:20902240-20902262 CTCAGAAAGCCAAATCCTGATGG - Intergenic
1171204665 20:23269571-23269593 CTCAGAAAGGCAATGTATGCTGG - Intergenic
1171441058 20:25163376-25163398 CACAGAAAGACAAATGCGGCAGG - Intergenic
1173328578 20:42055485-42055507 CTTAGAAAAACAAATACTGCTGG - Intergenic
1173639848 20:44593504-44593526 CACAGAAAGACAAATACTACAGG + Intronic
1175134919 20:56815880-56815902 CTCAGAAGGACAAAGTCTCAGGG + Intergenic
1175726431 20:61321693-61321715 CTGAGAAGCACCAATTCTGCAGG - Intronic
1175917091 20:62431076-62431098 GACAGAAAGACAAATACTGCAGG - Intergenic
1177449119 21:21242582-21242604 CACAGAAAGACTACTTCGGCAGG - Intronic
1177941277 21:27414865-27414887 CTCAGCAAAACAAAATCTGAGGG - Intergenic
1178098257 21:29238442-29238464 CACAGAAAGATAAATTTCGCAGG - Intronic
1178254851 21:31043148-31043170 ATCAGAAAAACAAATGCAGCTGG + Intergenic
1178436666 21:32565918-32565940 CTCAGAAAAGCAAATTCTGAGGG - Intergenic
1179589802 21:42399309-42399331 CGGAGAAAGACAAATACTGCAGG + Intergenic
1179626320 21:42651490-42651512 CTAAAAAAGAAAAATCCTGCGGG - Intergenic
1179820935 21:43936368-43936390 CTCAGACAGACGAACGCTGCAGG - Intronic
1180005958 21:45020735-45020757 CTAAGAGAGACAAATTCTAAGGG + Intergenic
1180147614 21:45930035-45930057 CTCAGAAAGAGAAAGTCCCCAGG - Intronic
1180464139 22:15595656-15595678 ATCAGCAACACAAACTCTGCGGG + Intergenic
1180926787 22:19560686-19560708 CACAGAAAGACAAATACCACAGG + Intergenic
1182675293 22:32034478-32034500 CACAGAGAGACGACTTCTGCAGG + Intergenic
1182698994 22:32217362-32217384 CACAGAAAGACAAATGCTATAGG - Intergenic
1184243801 22:43225696-43225718 CTCAGAAAGAAACATTTGGCCGG - Intronic
1184397787 22:44254900-44254922 CTGACAAGGGCAAATTCTGCAGG - Intronic
950080698 3:10220018-10220040 CTCAGAAAGACAAATGTGACAGG - Intronic
951608565 3:24465237-24465259 TTCTGAAAAACACATTCTGCTGG + Intronic
952061276 3:29513707-29513729 CTCGCAAAGACAAATTTTACAGG - Intronic
952332806 3:32380327-32380349 ACCAGAAAGACAAATACCGCAGG + Intergenic
952674176 3:36007288-36007310 CACAGAAAGAAAAATACTGTGGG + Intergenic
952726557 3:36592558-36592580 CTCAGAACGACATATTCAGAAGG + Intergenic
953090024 3:39714821-39714843 CTCAGAAAAACAAAAGCTGAGGG + Intergenic
955913853 3:63886147-63886169 CACAGAAAGACAAATACTGCAGG + Intronic
956037204 3:65106994-65107016 CACATAAAGGCAAATTCTACTGG - Intergenic
956501823 3:69894997-69895019 CCCAGAAAGACAACTTCCCCTGG - Intronic
956897814 3:73681847-73681869 CTCAGAAGAACACATTCTTCTGG + Intergenic
957399637 3:79692565-79692587 CACAGGAAGACAAGTCCTGCAGG + Intronic
957836841 3:85605261-85605283 CTCAGAAAGGCAAATTCCTGTGG + Intronic
957921558 3:86755503-86755525 CTCAGACAAACAAATGCTGAGGG - Intergenic
958257668 3:91343805-91343827 CTCAGACAGACAAAAGCTGAGGG - Intergenic
958769011 3:98403927-98403949 TTCAGATAAACAAATTCTGATGG + Intergenic
959174800 3:102893627-102893649 CATAGAAAGACAAATACTGCAGG + Intergenic
961102489 3:124212443-124212465 CTCAGAAATACAAATTGTAATGG + Intronic
961128641 3:124444891-124444913 CTCAGAAAGCCAAACTTGGCTGG + Intronic
962874971 3:139528865-139528887 CTCCAGAAGACAAATTCTGGGGG - Intronic
963324538 3:143847433-143847455 CCCAGAAAGAGCAATACTGCAGG + Intronic
963418545 3:145029177-145029199 CACAGAAAGACAAATTTTGCAGG + Intergenic
963488275 3:145964969-145964991 TTCATAAAGACAAATACTTCTGG - Intergenic
963638211 3:147825832-147825854 CTAAGAAATTCAAAATCTGCCGG + Intergenic
966480706 3:180405268-180405290 CTAAGAAAGCAAAATGCTGCCGG - Intergenic
968072526 3:195794705-195794727 CTCAGAGAGACAAAGTCTCAGGG + Intronic
968932641 4:3590014-3590036 CTCAGATACCCAAATGCTGCTGG - Intronic
969834163 4:9825758-9825780 TTGGGAAAGACAAAATCTGCAGG + Intronic
969877725 4:10148319-10148341 CACAGAGAATCAAATTCTGCAGG + Intergenic
970459688 4:16261006-16261028 CTGAGAAAAAAGAATTCTGCAGG - Intergenic
971671952 4:29572256-29572278 ATGAGAAAGAGAAATTCTGAAGG + Intergenic
972936814 4:44146570-44146592 CTAAGAAAAACAAACTTTGCAGG - Intergenic
973005363 4:44998806-44998828 CTCAGAATAACCAATTGTGCTGG - Intergenic
973223978 4:47761615-47761637 CACAGAAAGACAAATACCACAGG + Intronic
973709986 4:53620238-53620260 ATCAGAAATGCAAACTCTGCAGG - Intronic
973813524 4:54596673-54596695 CACAGAAAGACAAATACTGTAGG + Intergenic
974181176 4:58386482-58386504 CTAAGAAAGACTAAGTCTGCTGG + Intergenic
974496196 4:62631563-62631585 TTCAGACAGACAAATTCTAAGGG + Intergenic
976806171 4:89050028-89050050 CTGAGAAAGACAAATAGTACAGG + Intronic
977587368 4:98788583-98788605 CACAGAAAGACAAATACTGTAGG + Intergenic
978820899 4:112964422-112964444 CACAGAAAGACAAACTTTTCAGG - Intronic
980990024 4:139731206-139731228 GTCAGAAAGAAAAATCCTCCTGG + Intronic
982401022 4:154967880-154967902 CTTGGAAAAACAAATTATGCTGG + Intergenic
982519990 4:156404332-156404354 CACAGAAGGACAAATTCTACAGG + Intergenic
983195479 4:164801860-164801882 CACAGAATGACAAATTTTCCTGG - Intergenic
983395533 4:167189869-167189891 CTCAGAAAGACAAATATTGTAGG - Intronic
983541742 4:168918433-168918455 CACAGAAAGATAAATACTACAGG + Intronic
983552238 4:169029473-169029495 CCCAGAAAGACAAATTGTAAAGG + Intergenic
983970945 4:173873600-173873622 TACAGAAAGACAAATTTTGCAGG + Intergenic
984099791 4:175471690-175471712 CACAGAAAGACAAATACTACTGG - Intergenic
984158929 4:176227352-176227374 CTCAGAAATACAAATCCTAAGGG - Intronic
984529522 4:180899853-180899875 CTCAGACAAACAAAATCTGAGGG - Intergenic
984606731 4:181794532-181794554 CAAAGAAAAACAAATACTGCAGG - Intergenic
984614543 4:181882006-181882028 TTCAGAAAGTCAAACACTGCAGG + Intergenic
985178232 4:187226287-187226309 CACAGAAAGATGAATACTGCAGG - Intergenic
985281409 4:188289653-188289675 CCCAGAAAGACATGTTCTGTAGG + Intergenic
985481380 5:113098-113120 CTGAGAAAGACAAAATGTGCAGG - Intergenic
985936933 5:3104687-3104709 CTCAGAAAGAGACGTTCTGAAGG + Intergenic
986810806 5:11357427-11357449 CACAGAAAGACAAATACCACAGG + Intronic
986906260 5:12497038-12497060 CATAGAAACACAAATACTGCAGG + Intergenic
988161985 5:27530386-27530408 CTCAGACAAGCAAATTCTGATGG - Intergenic
988194072 5:27978697-27978719 CTCAGACAGAAAAATGCTGAGGG - Intergenic
988860931 5:35277904-35277926 CACAGAAAGACAAATACCACAGG - Intergenic
989291461 5:39771265-39771287 CTCACAAAAACCAATTCGGCCGG + Intergenic
989321597 5:40141234-40141256 CTTATCAAGGCAAATTCTGCAGG - Intergenic
989686484 5:44094115-44094137 CTCAGAAAGCATAATTCTGAAGG - Intergenic
991078323 5:62567122-62567144 CTCAGACAGACAAAAGCTGAGGG - Intronic
991906583 5:71519552-71519574 CACAGAAAGACAAATATTGCTGG - Intronic
992020024 5:72613612-72613634 CCCAGAAAAACAAATACTGCAGG - Intergenic
992653846 5:78888719-78888741 CTCAGATAGGAAAATTCTCCGGG + Intronic
993093577 5:83456996-83457018 CACAGAAAGACAAATACTGCAGG + Intergenic
993142092 5:84047148-84047170 CTCAGAAAGACAAGCTCTAGTGG - Intronic
995691573 5:114831506-114831528 CTCAGAAAAGCAAATGCTGAGGG + Intergenic
997049790 5:130366099-130366121 CACAGGAAGGCAAATACTGCAGG - Intergenic
997096307 5:130916962-130916984 CTCAAAAAGAAAAATGCTGGAGG + Intergenic
997152508 5:131513705-131513727 CTTAGAAAGACAAATTGTAAGGG - Intronic
998615937 5:143740642-143740664 GACAGAAAGTGAAATTCTGCTGG - Intergenic
1002310883 5:178313089-178313111 CACAGAAAGACAAATACGGAAGG + Intronic
1002597984 5:180336524-180336546 CAAAGAAAGACACATTCAGCTGG - Exonic
1002788258 6:419954-419976 CACAGAAGGACAAATACTGCAGG - Intergenic
1002863500 6:1100837-1100859 CTCAGAAAGACAAATTTACGGGG - Intergenic
1004619641 6:17321646-17321668 TTTAGAAAGACATATTCTCCAGG + Intergenic
1004856719 6:19758511-19758533 CCCAGAGAGACAAATCCTGGTGG - Intergenic
1006180979 6:32153403-32153425 CTCAGACAGCCAGATTCTGGGGG + Intronic
1007014491 6:38450159-38450181 GCCAGAAAGACAAATACTGCAGG + Intronic
1007737621 6:43991340-43991362 CTCTGAAAAGCAAATTCTGCTGG + Intergenic
1008298055 6:49802568-49802590 AACAGAAAAACAAATACTGCAGG - Intergenic
1008997635 6:57677096-57677118 CTCAGACAGACAAAAGCTGAGGG + Intergenic
1009186132 6:60576444-60576466 CTCAGACAGACAAAAGCTGAGGG + Intergenic
1009522538 6:64701595-64701617 CTTAGAAAATCAAATACTGCAGG + Intronic
1009803703 6:68574828-68574850 CACAGAAAGACAAATATTCCAGG + Intergenic
1010299302 6:74241806-74241828 CTCAGAAAAACAAAAGCTGAGGG - Intergenic
1011054320 6:83189883-83189905 CACATGAAGACAAATACTGCAGG + Intronic
1011306059 6:85928097-85928119 CACAGAAAGACAAACTTTACAGG - Intergenic
1011725029 6:90202427-90202449 CAGAGAAAAAAAAATTCTGCTGG + Intronic
1012079610 6:94738706-94738728 TTCAGAAAAACAAATCCTGAAGG + Intergenic
1012427207 6:99128030-99128052 ATCTGAAAGACAAATGCTGTAGG + Intergenic
1012559881 6:100567649-100567671 AACAGAAAACCAAATTCTGCAGG - Intronic
1017259216 6:152367165-152367187 TTGAGAAAAACAAATTCTGTAGG + Intronic
1017658855 6:156654757-156654779 CTCAGAAAGATACATTGTGGAGG - Intergenic
1017663289 6:156694758-156694780 CACAGAAGGACAAATACTGTGGG + Intergenic
1018445098 6:163850663-163850685 CTCAGAAAAACAAAAGCTGTAGG - Intergenic
1018652589 6:166004625-166004647 CACAGAAGGACAAACCCTGCAGG - Intergenic
1018815963 6:167331047-167331069 CTTAGAAAGCCAACTTGTGCAGG - Intronic
1019818899 7:3224550-3224572 CTCAGAAAAACAAAAACTGATGG - Intergenic
1020028193 7:4914390-4914412 ATGAAAGAGACAAATTCTGCAGG - Intronic
1020624431 7:10559914-10559936 CTCAGAAAAACAAAAGCTGAGGG + Intergenic
1021394935 7:20135589-20135611 CTCTGAATGAGAAATTCTGGTGG + Exonic
1021850104 7:24799674-24799696 CTCATACAGAACAATTCTGCTGG - Exonic
1022929910 7:35100455-35100477 TACAGAAAGACAAACTTTGCAGG + Intergenic
1023085946 7:36570256-36570278 CACAGAAGGACGAATACTGCCGG - Intronic
1023415342 7:39926942-39926964 TTCATAAAGATAAATTCTGAGGG + Intergenic
1023592652 7:41795920-41795942 CACAGAATGAGAAATTCTGGAGG + Intergenic
1024577401 7:50775679-50775701 CTCAGACAGAGAATTGCTGCAGG - Intronic
1026527117 7:71163715-71163737 TTCAGAAACACCAATTCTGAAGG + Intronic
1027256399 7:76433449-76433471 CTCTGAAAGACACAGTCAGCTGG - Exonic
1027446564 7:78280280-78280302 CAAAGAAAGACAAATTGTGGGGG + Intronic
1027481594 7:78704901-78704923 AACAGAAAAACAAATACTGCAGG + Intronic
1028151878 7:87383354-87383376 AATAGAAAGACAAATACTGCAGG - Intronic
1029825804 7:103192903-103192925 TACAGAAAGACAAACTTTGCAGG + Intergenic
1030768314 7:113440167-113440189 CTCAGAAAAACAAATGCTGAGGG - Intergenic
1031488144 7:122354610-122354632 CTAAGAACCAAAAATTCTGCAGG - Intronic
1031792822 7:126131912-126131934 CACAGAAAGACACATATTGCAGG + Intergenic
1032260871 7:130335802-130335824 CTCAGACAGACAAATACTGAGGG + Intergenic
1033415717 7:141159697-141159719 CACAGTAAGACAAATACTGTAGG + Intronic
1034504371 7:151474703-151474725 CTCAGAAAGAGCAATTCTACAGG + Intronic
1035567906 8:653939-653961 CACAGAAGGACAAATCCCGCAGG + Intronic
1036775653 8:11611089-11611111 CAGAGAAAGACAAATATTGCAGG + Intergenic
1037213524 8:16420977-16420999 CTAAGAAAGTCAGATTCTGGAGG - Intronic
1037622400 8:20576317-20576339 CACAGAAGGACAAATACTGTAGG - Intergenic
1040408984 8:47135564-47135586 CACAGAAAGACAGATACTGCAGG - Intergenic
1040613522 8:49010697-49010719 CTAAGAAAAACAAATTCTTCAGG - Intergenic
1040856625 8:51954877-51954899 CTCCTAAAGACAGGTTCTGCTGG - Intergenic
1041741448 8:61161546-61161568 CATAGAAAGACAAATACTACAGG + Intronic
1043298506 8:78697422-78697444 CTTAAAAAGTCAAATTCTCCTGG + Exonic
1043367091 8:79545119-79545141 CCCAGAAAAACAAATGCTGAGGG + Intergenic
1043991187 8:86757128-86757150 CACAAAAAAACAAATTCTGGAGG - Intergenic
1044097899 8:88091288-88091310 CTAAGGAAGAAAAAATCTGCAGG - Intronic
1044492706 8:92838754-92838776 TTCAGACATACAAATGCTGCAGG - Intergenic
1044515072 8:93128148-93128170 TTCAGAAACACAACTTCTACTGG + Intergenic
1044763725 8:95549491-95549513 CTAAGAAGGATGAATTCTGCTGG - Intergenic
1045800885 8:106098998-106099020 CTCAGAAAAACAAAAGCTGAGGG + Intergenic
1045921664 8:107537370-107537392 CTCAGAAAGCTTAACTCTGCTGG - Intergenic
1046140138 8:110080856-110080878 TACAGAAAGACAAATACTGAAGG + Intergenic
1046469072 8:114644559-114644581 CTGAGAAAGACAATTGCAGCTGG + Intergenic
1046701633 8:117407258-117407280 CTCAGAAACAGGAATCCTGCTGG + Intergenic
1046819530 8:118620849-118620871 CTCAGAAACCAAAATTCTGCAGG + Intronic
1046857417 8:119049042-119049064 CTCAGACAAACAAATGCTGAGGG - Intronic
1047634085 8:126741517-126741539 TTCAGACAGACAAATGCTGAGGG - Intergenic
1048108255 8:131436852-131436874 CACAGAAAGACAAATTTTGCAGG + Intergenic
1048418112 8:134249667-134249689 CTAGGAATGACAAATTCAGCAGG - Intergenic
1048519134 8:135137702-135137724 GTGAGAAAGACAAATTTTGGGGG - Intergenic
1049807027 8:144545811-144545833 CTGAGAAGGACAAATGCGGCTGG + Intronic
1049898652 9:136740-136762 TTAAGAAAGGCAAATTTTGCTGG + Intronic
1050301120 9:4259945-4259967 TACACAAAGACAAAGTCTGCTGG - Intronic
1050723528 9:8619438-8619460 CACAGAAAGACAAATGCTATGGG - Intronic
1051945391 9:22563383-22563405 CACAGAAGGACAAATATTGCGGG + Intergenic
1052266626 9:26581275-26581297 CACAGAAAGATAAACACTGCAGG + Intergenic
1053563357 9:39220035-39220057 CACAGAAAGACCAATACTACAGG - Intronic
1053741702 9:41147051-41147073 TTAAGAAAGGCAAATTTTGCTGG + Intronic
1053829145 9:42057956-42057978 CACAGAAAGACCAATACTACAGG - Intronic
1054133790 9:61399031-61399053 CACAGAAAGACCAATACTACAGG + Intergenic
1054346968 9:63976862-63976884 TTAAGAAAGGCAAATTTTGCTGG + Intergenic
1054444696 9:65303198-65303220 TTAAGAAAGGCAAATTTTGCTGG + Intergenic
1054457480 9:65441881-65441903 CTCAGATACCCAAATGCTGCTGG + Intergenic
1054485574 9:65718305-65718327 TTAAGAAAGGCAAATTTTGCTGG - Intronic
1054601415 9:67129491-67129513 CACAGAAAGACCAATACTACAGG + Intergenic
1054686639 9:68284249-68284271 TTAAGAAAGGCAAATTTTGCTGG - Intronic
1054737748 9:68772608-68772630 CCCAGACACACAGATTCTGCTGG + Intronic
1055341727 9:75291725-75291747 CACAGAAAGACAAATGTTGCAGG - Intergenic
1055987834 9:82070199-82070221 CACAGAAAAGCAAATACTGCTGG - Intergenic
1056380818 9:86055689-86055711 CACAGAAGGACAAATGCTGTAGG + Intronic
1057569351 9:96192367-96192389 CTCAGCTAGACAAAGTCTCCTGG + Intergenic
1057857613 9:98613644-98613666 ACCCAAAAGACAAATTCTGCAGG + Intronic
1057977450 9:99621169-99621191 CACAGGAAGATAAATACTGCAGG + Intergenic
1059713795 9:116894423-116894445 CTCAGAATTACAAATCATGCTGG - Intronic
1059824662 9:118015717-118015739 CTCTGAAGGACAAATTCTGTGGG + Intergenic
1059915769 9:119098284-119098306 CACAGAAAGATAAATCCTGCAGG + Intergenic
1060438257 9:123614852-123614874 GTCAGAAAGAAAAACTCTGAAGG + Intronic
1061576375 9:131509560-131509582 GGCAAAAAGAAAAATTCTGCTGG + Intronic
1062558639 9:137129299-137129321 CTCAGCGACCCAAATTCTGCGGG - Intergenic
1185879907 X:3731766-3731788 CACGGAAAGACAAATACTGCAGG + Intergenic
1186621877 X:11250227-11250249 ATCAAAAAGAAAAATTCTGTTGG + Intronic
1187178473 X:16918679-16918701 CATAGAAAGACAAATACCGCAGG + Intergenic
1187929970 X:24284936-24284958 CTTAAAACAACAAATTCTGCCGG - Intergenic
1188716147 X:33462123-33462145 CTCAGAAAAACAAAAGCTGAGGG - Intergenic
1188773597 X:34185862-34185884 ATCAGAAAGATAAATTCTTGAGG - Intergenic
1188875064 X:35419364-35419386 CGCAAAAAGACAAATACTGTAGG - Intergenic
1189506322 X:41614817-41614839 CTCAGAAAAAAAAATTATCCAGG - Intronic
1190269190 X:48849336-48849358 CAAAAAAAGACAAATACTGCAGG - Intergenic
1191021716 X:55867619-55867641 CTCAGAAACGCAAATTCTTAAGG + Intergenic
1191603555 X:63037240-63037262 AACAGAAAGTCAAATACTGCAGG - Intergenic
1192067436 X:67901632-67901654 CTCAGATAGGCAAATGCTGAGGG - Intergenic
1192569405 X:72190653-72190675 TTAAGAAAGAAAAATTCAGCCGG + Intronic
1193192285 X:78585394-78585416 AACAGAAAGACAAATTTTACAGG - Intergenic
1193847460 X:86492084-86492106 GTCACAGAGACAAATACTGCAGG - Intronic
1194489438 X:94528375-94528397 CATAGAAAGAAAAATACTGCAGG - Intergenic
1194829489 X:98603729-98603751 CTGAGAAAGACAAACTTTACAGG - Intergenic
1194901977 X:99522858-99522880 TTCAGACAGACAAATGCTGAGGG + Intergenic
1195215405 X:102695378-102695400 CTCAGATAAACAAAATCTGAGGG + Intergenic
1195396347 X:104414232-104414254 CCCAGAAAAACAAAAGCTGCGGG + Intergenic
1195428245 X:104760039-104760061 CACAGAAAGACAAACTTAGCAGG - Intronic
1196083781 X:111661787-111661809 CTCCGGAAGACAAGTTCTGAGGG + Intergenic
1196142633 X:112281232-112281254 CACAGAAAGACAAATGCCACAGG - Intergenic
1196749144 X:119098948-119098970 CTCAGAAAGGCAACTTCTGGTGG - Intronic
1197669321 X:129258776-129258798 GCCAGAACCACAAATTCTGCAGG - Intergenic
1198609797 X:138384948-138384970 CTCAGAGAAGCAAATTCTGAGGG + Intergenic
1199010361 X:142750970-142750992 CACAGAAAGACAAATACTGCAGG - Intergenic
1200223870 X:154405888-154405910 CACAAAAAGACAAATACTGTAGG - Intronic
1200362963 X:155630426-155630448 CTCAGACAAACAAAATCTGAGGG - Intronic
1200372524 X:155741778-155741800 TTCAGAAAAACAAATGCTGAGGG + Intergenic
1200674855 Y:6137510-6137532 CTCAGACAGACAAATACTAAGGG + Intergenic
1200751064 Y:6944651-6944673 CACAAAAAGATAAATACTGCAGG - Intronic
1201335601 Y:12877796-12877818 CACAAAAAGACAAATACTGCAGG + Intergenic
1202027586 Y:20540965-20540987 GTCAGAAAGACAAATTCCTGGGG + Intergenic
1202242920 Y:22789100-22789122 CTCAGACAGACAAACCTTGCTGG + Intergenic
1202395907 Y:24422850-24422872 CTCAGACAGACAAACCTTGCTGG + Intergenic
1202474878 Y:25247242-25247264 CTCAGACAGACAAACCTTGCTGG - Intergenic