ID: 1168091371

View in Genome Browser
Species Human (GRCh38)
Location 19:54087304-54087326
Sequence TATTAAGTAAGACCACCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168091370_1168091371 -9 Left 1168091370 19:54087290-54087312 CCAGGGCAACAAAATATTAAGTA No data
Right 1168091371 19:54087304-54087326 TATTAAGTAAGACCACCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168091371 Original CRISPR TATTAAGTAAGACCACCAAA TGG Intergenic
No off target data available for this crispr