ID: 1168091875

View in Genome Browser
Species Human (GRCh38)
Location 19:54091009-54091031
Sequence CTTTTTTATGAGATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168091873_1168091875 15 Left 1168091873 19:54090971-54090993 CCGGTGGTGAAGGAGATTCTTTT No data
Right 1168091875 19:54091009-54091031 CTTTTTTATGAGATGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168091875 Original CRISPR CTTTTTTATGAGATGGAGCT TGG Intergenic
No off target data available for this crispr