ID: 1168095157

View in Genome Browser
Species Human (GRCh38)
Location 19:54110245-54110267
Sequence CGGAGGGATGGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2523
Summary {0: 1, 1: 0, 2: 13, 3: 245, 4: 2264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168095157_1168095172 21 Left 1168095157 19:54110245-54110267 CCTTCCACCTTCCCATCCCTCCG 0: 1
1: 0
2: 13
3: 245
4: 2264
Right 1168095172 19:54110289-54110311 AGTCCTGAGTGCCCTCCAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 129
1168095157_1168095174 23 Left 1168095157 19:54110245-54110267 CCTTCCACCTTCCCATCCCTCCG 0: 1
1: 0
2: 13
3: 245
4: 2264
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095157_1168095173 22 Left 1168095157 19:54110245-54110267 CCTTCCACCTTCCCATCCCTCCG 0: 1
1: 0
2: 13
3: 245
4: 2264
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095157_1168095171 20 Left 1168095157 19:54110245-54110267 CCTTCCACCTTCCCATCCCTCCG 0: 1
1: 0
2: 13
3: 245
4: 2264
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168095157 Original CRISPR CGGAGGGATGGGAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr