ID: 1168095171

View in Genome Browser
Species Human (GRCh38)
Location 19:54110288-54110310
Sequence CAGTCCTGAGTGCCCTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 218}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168095157_1168095171 20 Left 1168095157 19:54110245-54110267 CCTTCCACCTTCCCATCCCTCCG 0: 1
1: 0
2: 13
3: 245
4: 2264
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095162_1168095171 8 Left 1168095162 19:54110257-54110279 CCATCCCTCCGGCTCCCCTCTCA 0: 1
1: 1
2: 2
3: 84
4: 860
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095163_1168095171 4 Left 1168095163 19:54110261-54110283 CCCTCCGGCTCCCCTCTCACCAT 0: 1
1: 0
2: 0
3: 36
4: 332
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095156_1168095171 28 Left 1168095156 19:54110237-54110259 CCTGAGGTCCTTCCACCTTCCCA 0: 1
1: 1
2: 3
3: 26
4: 341
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095164_1168095171 3 Left 1168095164 19:54110262-54110284 CCTCCGGCTCCCCTCTCACCATG 0: 1
1: 1
2: 2
3: 26
4: 316
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095167_1168095171 -7 Left 1168095167 19:54110272-54110294 CCCTCTCACCATGCCACAGTCCT 0: 1
1: 0
2: 3
3: 35
4: 579
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095168_1168095171 -8 Left 1168095168 19:54110273-54110295 CCTCTCACCATGCCACAGTCCTG 0: 1
1: 0
2: 1
3: 37
4: 429
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095161_1168095171 9 Left 1168095161 19:54110256-54110278 CCCATCCCTCCGGCTCCCCTCTC 0: 1
1: 0
2: 3
3: 58
4: 762
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095159_1168095171 16 Left 1168095159 19:54110249-54110271 CCACCTTCCCATCCCTCCGGCTC 0: 1
1: 0
2: 1
3: 75
4: 881
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095166_1168095171 -6 Left 1168095166 19:54110271-54110293 CCCCTCTCACCATGCCACAGTCC 0: 1
1: 0
2: 1
3: 39
4: 497
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095160_1168095171 13 Left 1168095160 19:54110252-54110274 CCTTCCCATCCCTCCGGCTCCCC 0: 1
1: 0
2: 4
3: 109
4: 1492
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218
1168095165_1168095171 0 Left 1168095165 19:54110265-54110287 CCGGCTCCCCTCTCACCATGCCA 0: 1
1: 0
2: 3
3: 58
4: 622
Right 1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG 0: 1
1: 0
2: 0
3: 21
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168095171 Original CRISPR CAGTCCTGAGTGCCCTCCAG TGG Intronic
900226617 1:1536139-1536161 CCGTCCTGAGCCCCCTCCGGGGG - Intronic
900265186 1:1753711-1753733 CACCCCTGAGTGCTCGCCAGAGG + Intronic
900608214 1:3533232-3533254 CCGTCCTGTCTGCCATCCAGAGG + Intronic
900931556 1:5741242-5741264 CAGTCCTGACTCCCTTCCTGGGG + Intergenic
901061035 1:6471996-6472018 CAGTCCTCATAGCCCTCCCGAGG + Intronic
901627333 1:10631582-10631604 CAGTACTGGGGACCCTCCAGTGG - Intergenic
902165086 1:14563675-14563697 GAGAGCTGACTGCCCTCCAGGGG - Intergenic
903570511 1:24301064-24301086 CAGCCCTGAGTGCCCTCCCAGGG - Intergenic
904378445 1:30095945-30095967 CCACCCTGAGTGCCCTGCAGGGG + Intergenic
904700869 1:32357323-32357345 AAGTCCTGGGGGCCCTCTAGGGG + Intronic
905733160 1:40310190-40310212 CAGTCCTGGCTGAACTCCAGGGG + Intronic
906186780 1:43868466-43868488 CAGTCCTGAGTGCCAGCCTATGG - Intronic
906963972 1:50438531-50438553 CAGTCCTGGGTCCCCACAAGTGG - Intergenic
907851840 1:58262201-58262223 CACTCCTTAGTGCCCTCTATAGG - Intronic
912673758 1:111656584-111656606 CAGTCTCCAGTGACCTCCAGTGG + Intronic
913320118 1:117582212-117582234 CAGGCCAGAGTGCCGTGCAGTGG - Intergenic
918093890 1:181318721-181318743 CAGTCCCGAGTCGCCTCCAAAGG - Intergenic
920433539 1:205934120-205934142 CAGTCTTGGGTGACATCCAGGGG - Intronic
921954432 1:220967510-220967532 CAGTGCTGGGTGCCCTCCCCTGG + Intergenic
922097305 1:222453431-222453453 CAGTCTCGAGTGCCCTTCTGAGG - Intergenic
922756872 1:228101830-228101852 AGGTCCTGAGTGCCCTCCCACGG + Intronic
924426549 1:243955875-243955897 CAGTTCTGAGTCCCCTCCGTCGG + Intergenic
924561985 1:245164730-245164752 CCTTCATGAGTGCCCTCCAATGG - Intronic
924616304 1:245614597-245614619 CAGCCCTGAGCTGCCTCCAGTGG + Intronic
1066441355 10:35442217-35442239 CAGTGCTGGTTGCCCTCCAAGGG + Intronic
1067366872 10:45639753-45639775 CATTGCTGAGTGCTCTGCAGGGG + Intronic
1069310078 10:67024105-67024127 CAGGACTGTGTTCCCTCCAGAGG + Intronic
1074023295 10:109607304-109607326 AAGTCCTGAGTGACCTACAAAGG + Intergenic
1076354174 10:129840197-129840219 CAGTGCTGGGTCCTCTCCAGGGG - Intronic
1076644550 10:131943651-131943673 CTCTCCTGTGTGTCCTCCAGTGG - Intronic
1076811852 10:132890529-132890551 CAGTGCGGAGTCCCCCCCAGAGG + Intronic
1077187403 11:1241484-1241506 CTGGCATAAGTGCCCTCCAGCGG - Exonic
1077315194 11:1916571-1916593 CAGTGCTGAGTGCCCAACTGTGG - Intergenic
1077578052 11:3399215-3399237 CAGCCCAGAGTGCTCTCTAGAGG + Intergenic
1077910819 11:6570267-6570289 CTGTCCTCAGTGTCCCCCAGAGG - Exonic
1079010771 11:16826390-16826412 CGGTCCCGCTTGCCCTCCAGTGG + Exonic
1079159495 11:17978770-17978792 AAGGCCTGGGTGACCTCCAGGGG + Intronic
1079177254 11:18153715-18153737 CAGTCCTGTGTGCCCTGCTCTGG + Intronic
1082999058 11:59275191-59275213 CAGTTCTGCCTGCCTTCCAGTGG - Intergenic
1085488442 11:76889223-76889245 CAGTTATGACTGCCCTTCAGAGG - Intronic
1085645418 11:78219285-78219307 CAGTCCTCAGAGCCTTCCAAGGG - Exonic
1086851994 11:91820513-91820535 TAATACTGTGTGCCCTCCAGTGG + Intergenic
1087038202 11:93774253-93774275 CAGGCCTGGTTGCCCACCAGTGG - Intronic
1087453613 11:98354625-98354647 CAGTGCTGCCTTCCCTCCAGGGG + Intergenic
1088309741 11:108447134-108447156 AAGTCCTGAGTGACCTACAAAGG + Intronic
1089311605 11:117561719-117561741 CCTTCCTGAGTGACCTCCAAGGG - Intronic
1090976384 11:131683790-131683812 CAACCCAGAGTGCCCCCCAGGGG - Intronic
1091599886 12:1911728-1911750 CAGTCCTGAGACACCCCCAGAGG - Intronic
1093617830 12:21249793-21249815 CTGTCCTCAGTGCCCTCTACCGG + Intergenic
1093684207 12:22038158-22038180 CAGTCCTGAGTTCCTTCTGGAGG + Intergenic
1096251174 12:50033366-50033388 CAGTCTTGAGTCCCAGCCAGAGG - Intergenic
1098308569 12:69125353-69125375 CAATCCTGAGTGCCTACCACGGG - Intergenic
1099956561 12:89356542-89356564 GAGGCCTCAGTGCCCTTCAGAGG + Intergenic
1100889687 12:99111050-99111072 TTGTCCTGATTGCCTTCCAGGGG - Intronic
1101589770 12:106115484-106115506 GGCTCCTGAGTGCTCTCCAGAGG - Intronic
1101824699 12:108210981-108211003 CACTCCTGGGTCCCCTCCTGGGG + Intronic
1102246795 12:111361467-111361489 CAGTCCTCAGTGCCCCACACCGG - Exonic
1104505483 12:129327988-129328010 CAGCCCTGAGTGCTTTCGAGTGG - Intronic
1108208813 13:48117889-48117911 CAGACCTCAGTGAGCTCCAGGGG + Intergenic
1111835777 13:93386781-93386803 CAGGACTGAGTTCCCTCCAGAGG + Intronic
1113839141 13:113348715-113348737 CAGTCCTGGGTGCCCCTCGGCGG - Intronic
1114615860 14:24068028-24068050 TAGGCCAGAGTCCCCTCCAGAGG + Intronic
1118593144 14:67416331-67416353 CAGTTCTGAGTCTCTTCCAGGGG - Intergenic
1119851681 14:77870872-77870894 CAGCCCTGAGTGGCCTGCAGGGG - Intronic
1120079825 14:80203135-80203157 CAGCCCTGAGCGCCCACTAGTGG - Exonic
1121951559 14:98175262-98175284 CATCCCTGAGGGCTCTCCAGAGG - Intergenic
1122812572 14:104296329-104296351 CAGCCCTGCCTGCCCTCCTGGGG - Intergenic
1122836645 14:104433955-104433977 CCGTCCTTCCTGCCCTCCAGAGG + Intergenic
1123203698 14:106692083-106692105 CTGTCCTGAGTGCCCCCTGGTGG + Intergenic
1123203730 14:106692200-106692222 CTGTCCTGAGTGACCCCTAGTGG + Intergenic
1202856504 14_GL000225v1_random:54530-54552 CAGGCCTGACAACCCTCCAGTGG + Intergenic
1202857456 14_GL000225v1_random:59796-59818 CAGGCCTGACACCCCTCCAGCGG + Intergenic
1202859222 14_GL000225v1_random:71501-71523 CAGACCTGATACCCCTCCAGCGG - Intergenic
1202922276 14_KI270723v1_random:36375-36397 CAGGCCTGACACCCCTCCAGCGG + Intergenic
1202922662 14_KI270724v1_random:1239-1261 CAGGCCTGACACCCCTCCAGCGG - Intergenic
1125317104 15:38442667-38442689 CAGTCCTTTCTGCCCTCCATGGG + Intergenic
1128685983 15:69685971-69685993 CAGACTTGAGAGCCCTCCAGAGG - Intergenic
1129741847 15:77993088-77993110 CAGACCTCAGTGCCCACCATGGG + Intronic
1129843861 15:78759371-78759393 CAGACCTCAGTGCCCACCACGGG - Exonic
1130257948 15:82334429-82334451 CAGACCTCAGTGCCCACCACGGG + Intergenic
1130596986 15:85255534-85255556 CAGACCTCAGTGCCCACCACGGG - Intergenic
1130602408 15:85285348-85285370 CAATTCTGAGTGCACTCCATTGG + Intergenic
1130766476 15:86876368-86876390 CAATTCTGAATGCCCTCCATCGG - Intronic
1132339984 15:101072155-101072177 AAGTCCAGAATGCCCTCCAAGGG - Intronic
1134077106 16:11299761-11299783 CAGACCTGAGTGCCCCTCATTGG - Intronic
1134475084 16:14566454-14566476 CATTGCTGAGCTCCCTCCAGAGG - Intronic
1136028578 16:27486084-27486106 CCGACCAGAGTGCCCTGCAGCGG - Exonic
1136792727 16:32983424-32983446 GTGTCCTGAGTGCCCCCCTGGGG - Intergenic
1136877129 16:33870630-33870652 GTGTCCTGAGTGCCCCCCTGGGG + Intergenic
1138351551 16:56348711-56348733 CAGGCCTGACTGCCCTCCCTCGG - Intronic
1138502959 16:57459816-57459838 CAGTCCTGAGGGCCTTCCCAAGG + Intronic
1139344969 16:66296896-66296918 GAGTCCTGAGAGCACCCCAGGGG - Intergenic
1141140318 16:81492999-81493021 CAGCCCAGAGTCCCTTCCAGGGG - Intronic
1144955198 17:19015542-19015564 CAGTCCTGAGTGCTGGCCCGGGG - Intronic
1145911805 17:28547461-28547483 CAGTCCTGAAGCCCCTGCAGTGG - Intronic
1148031825 17:44627358-44627380 CAGTCCTGCGAGGCCTCCAAGGG - Intergenic
1148491275 17:48025318-48025340 CAGTGCTCAGCGCACTCCAGGGG + Intergenic
1149608713 17:57943206-57943228 TAGTGGTGAGTTCCCTCCAGGGG - Intronic
1149796758 17:59528090-59528112 CGGACATGAGTGCCCTCCTGGGG - Intergenic
1151908717 17:77066960-77066982 CAGTCTTGACTGCCATCTAGTGG + Intergenic
1154073430 18:11176638-11176660 CAATCCTGAGAGCCTTACAGAGG - Intergenic
1155199980 18:23508692-23508714 CTGTCCTGCCTGCCCTGCAGTGG + Intronic
1155416102 18:25601424-25601446 CATTTCTGAAAGCCCTCCAGTGG + Intergenic
1158337947 18:56434100-56434122 CAGACCTGAATGCCCCCAAGTGG - Intergenic
1160679377 19:405762-405784 CACACCTGTGAGCCCTCCAGAGG - Exonic
1160825947 19:1080662-1080684 CAGTCCTGATTCCCGCCCAGGGG + Exonic
1161495388 19:4583515-4583537 CAGGCCTCAGTGGCCCCCAGCGG - Intergenic
1163755266 19:19102914-19102936 CAGGGCTGCGTTCCCTCCAGAGG + Intronic
1164443434 19:28297724-28297746 CAGTCCTGAGTGCAGCCCTGTGG - Intergenic
1165247449 19:34505445-34505467 CAGTCCTGAGGGCCCACAGGGGG - Exonic
1165763053 19:38333771-38333793 CAGTCATGAGTGGCCTAGAGGGG + Intergenic
1166435289 19:42762336-42762358 GAGCCCTGAGAACCCTCCAGTGG + Intronic
1167647207 19:50712201-50712223 CCGTCCTGGGTGACCTACAGTGG + Intronic
1168095171 19:54110288-54110310 CAGTCCTGAGTGCCCTCCAGTGG + Intronic
926156763 2:10459663-10459685 AAGTCCTGAGTGCAGTCTAGTGG - Intergenic
927992705 2:27459477-27459499 CCGCCCTGGGTGCCCGCCAGTGG - Exonic
929548779 2:42875742-42875764 CAGTCCTCTGTCCCCTTCAGTGG - Intergenic
931590785 2:63880877-63880899 CAGGCCTGTGGGCACTCCAGGGG - Intronic
932573959 2:72952626-72952648 CATTCCTGGGTGCCCTCTGGTGG + Intronic
933519290 2:83349838-83349860 AAGTCCTGAGTGACCTACAAAGG + Intergenic
933912932 2:86960050-86960072 CTGTCCTCAGGGCCCTCCTGGGG - Intronic
934010063 2:87809840-87809862 CTGTCCTCAGGGCCCTCCTGGGG + Intronic
934354148 2:92473762-92473784 TAGTCCTGAGAGCGCTCCAAAGG - Intergenic
934382998 2:92935279-92935301 TAGTCCTGAGAGCGCTCCAAAGG - Intergenic
934426662 2:93638744-93638766 CAGTCCTGAGAGCGCTCCAAAGG - Intergenic
934452131 2:94050091-94050113 CAGTCCTGAGAGCGCTCCAAAGG - Intergenic
934454400 2:94086588-94086610 CAGTCCTGAGAGCGCTCCAAAGG - Intergenic
935773633 2:106450548-106450570 CTGTCCTCAGGGCCCTCCTGGGG + Intronic
935906431 2:107845392-107845414 CTGTCCTCAGGGCCCTCCTGGGG - Intronic
936128215 2:109810501-109810523 CTGTCCTCAGGGCCCTCCTGGGG - Intronic
936216482 2:110560984-110561006 CTGTCCTCAGGGCCCTCCTGGGG + Intronic
936392970 2:112092412-112092434 AAGAGCTGAGTGCCTTCCAGAGG + Intronic
936403683 2:112184361-112184383 CACTCCTCAGAGCCCTGCAGCGG - Intronic
936425623 2:112415555-112415577 CTGTCCTCAGGGCCCTCCTGGGG + Intronic
937201854 2:120209172-120209194 CAGGCCTGGCTGCCCTCCTGAGG + Intergenic
942185573 2:173421787-173421809 GAGTCCTGAGAGCCCTGCACTGG - Intergenic
943578824 2:189661184-189661206 GAGTTCTGTGCGCCCTCCAGTGG - Intergenic
946329796 2:219002629-219002651 CCGTCCGGAGCGCCCTCCACTGG + Intergenic
948602251 2:239114009-239114031 CAGTGCTCAGTGGTCTCCAGAGG - Intronic
948844027 2:240674677-240674699 CAGTCCTGTGTGGCATCCAGAGG - Intergenic
948849783 2:240699958-240699980 CAGTCCTGTGTGGCATCCAGAGG + Intergenic
1169190960 20:3659159-3659181 CTGGCCTGTGTGACCTCCAGTGG - Intergenic
1172118461 20:32584640-32584662 CAGTTCTGGGTGCGCTCCAAGGG - Intronic
1174138051 20:48393977-48393999 CAGGGCTGTGTTCCCTCCAGGGG - Intergenic
1176131175 20:63497469-63497491 GAGGCCTGAGTGCCCCACAGCGG + Intronic
1178261496 21:31104234-31104256 CAGGACTGAGTGCACTGCAGTGG - Intergenic
1178268214 21:31165015-31165037 CAGTGCTGAGACCGCTCCAGAGG - Exonic
1178422061 21:32451041-32451063 CAGCCCAGAGTGCTCTCTAGAGG - Intronic
1179815993 21:43906737-43906759 CAGGCCTGTGTGCCCTGCGGAGG + Intronic
1180062345 21:45392067-45392089 TACTCCTGAGTGCCCTCCGTGGG + Intergenic
1180594158 22:16962746-16962768 CAGTCCTCAGAGCCTCCCAGGGG - Exonic
1181686433 22:24532306-24532328 CTGACCTGAATGCCTTCCAGGGG + Intergenic
1182687095 22:32129541-32129563 TAGTCCTCAGTGCCCTCCGTGGG + Intergenic
1183033115 22:35120245-35120267 CAGCCATGCTTGCCCTCCAGGGG - Intergenic
1183588700 22:38767781-38767803 CAGTTCTGAGCTCCCTGCAGGGG - Intronic
1185069995 22:48650957-48650979 CAGTCCTCAGTGCCGTGCTGTGG - Intronic
950136972 3:10588381-10588403 CTGTCTTGAGTGCCCAGCAGTGG + Intronic
954934159 3:54311591-54311613 CAGACCAGTGTGCCCTCCAGAGG + Intronic
956072337 3:65466713-65466735 AAGTCCTGAGTTCCCTCAAGTGG + Intronic
956207982 3:66773481-66773503 CACTCCTGACTGCCCTACTGTGG + Intergenic
956250777 3:67231597-67231619 CAGTCCTCAGTCTCCTCCATGGG + Intergenic
956700610 3:71955659-71955681 AATTCCAGAGTGCCCTCAAGTGG - Intergenic
957049228 3:75398515-75398537 CAGTCCAGAGTGCTCTCTAGAGG + Intergenic
959835048 3:110908598-110908620 CAGTCTTGAGTTGGCTCCAGAGG + Intergenic
961821658 3:129578420-129578442 CAGTCCTGAGGGCTCTGCAGAGG + Exonic
961881548 3:130064996-130065018 CAGTCCAGAGTGCTCTCTAGAGG + Intergenic
962600952 3:136990503-136990525 CAGGCCTGAGAGGCCTCGAGAGG - Intronic
963002237 3:140692837-140692859 CAGTACTGAGTGCCCTTCATGGG - Intronic
964375523 3:156045060-156045082 CAGCCCAGAGTGCTCTCTAGAGG - Intronic
968531057 4:1091885-1091907 CAGTCCTGGGTGCCACCCCGTGG + Intronic
968709418 4:2102183-2102205 CAGTGTTAAGTGCCCCCCAGTGG - Intronic
968993859 4:3933102-3933124 CAGCCCAGAGTGCTCTCTAGAGG + Intergenic
969255809 4:6000927-6000949 CGGTGCTGAGTCCCCTCCAAGGG + Intergenic
969614925 4:8246733-8246755 CACCCCTGGGTGCCCTCGAGAGG - Intergenic
969822366 4:9730486-9730508 CAGCCCAGAGTGCTCTCTAGAGG - Intergenic
979456086 4:120927537-120927559 GGGCCCTGAGTGCCCTCCATGGG + Intergenic
979478988 4:121192607-121192629 GAGTGCAGAGTGCCCTCTAGAGG - Intronic
979522990 4:121689727-121689749 CCTGCCTGAGTGTCCTCCAGTGG - Intronic
984387870 4:179086994-179087016 CATTACTGAGTTCCCTCCAATGG + Intergenic
986308904 5:6536601-6536623 GGGTCCTGAGTTCCCTGCAGGGG - Intergenic
987095517 5:14545966-14545988 CAGCCCTCAGTGTCCTCCTGTGG - Intergenic
987864363 5:23521150-23521172 TAGTCTTGAGTGCTGTCCAGAGG - Exonic
990296454 5:54406201-54406223 CAGTCCTGGCAGCCCCCCAGCGG - Intergenic
993047625 5:82886191-82886213 CATGCCAAAGTGCCCTCCAGTGG - Intergenic
994270421 5:97770238-97770260 AAGTCCTGAGTGACCTACAAAGG - Intergenic
997068235 5:130589133-130589155 CAGAGCTGGGTGTCCTCCAGTGG - Intergenic
998153283 5:139769399-139769421 AGGCCCTGAGTGCCCTCCATTGG - Intergenic
999240639 5:150125420-150125442 CAGTCCTGAGAGGCCTCATGTGG - Intronic
999257562 5:150218029-150218051 CAGTGCTCTGTTCCCTCCAGGGG - Intronic
999880247 5:155855085-155855107 CGGTCCAGAGTGCACTACAGAGG - Intergenic
1000329793 5:160197569-160197591 CAGTGCTGAGAGCCCTCCCTAGG - Intronic
1001454762 5:171852262-171852284 CACACCTGAGTGCCCTCCTAAGG + Intergenic
1002208450 5:177580578-177580600 CAGGGCTGTGTTCCCTCCAGAGG - Intergenic
1002709235 5:181184253-181184275 GAGTCCTGAGCGCCCCCGAGCGG + Intergenic
1006023047 6:31128887-31128909 CAGTCCTCCCTGCCCTCAAGGGG - Intronic
1006467752 6:34206239-34206261 CTGTCCTCAGGGCCCTCCTGGGG - Intergenic
1006925211 6:37650228-37650250 CCGTCCGGAGTCTCCTCCAGGGG + Exonic
1006926525 6:37658476-37658498 CAGCGCTGAGTGCCCTGCAACGG + Intronic
1007305384 6:40899925-40899947 GAGTCCTGAGGGCCGCCCAGAGG + Intergenic
1007925023 6:45643486-45643508 CAGACAGGAGAGCCCTCCAGAGG - Intronic
1008685697 6:53924224-53924246 CAGTTGTGAGTGACCTCCTGTGG + Intergenic
1008714034 6:54266711-54266733 CAGTCCTGAGAGCCCCCTAGAGG + Intergenic
1008900679 6:56611894-56611916 CAGTGCTGAGTGCCCACCTGCGG - Intronic
1010848832 6:80746720-80746742 AAGTCCTGAGTGACCTACAAAGG + Intergenic
1012552177 6:100473653-100473675 CAGTCCTGTGTCCCATCCAGAGG + Intergenic
1013290267 6:108713333-108713355 CACTCCTGAGTGACCTGCAGGGG - Intergenic
1018170570 6:161140170-161140192 CGGCCCTCAGAGCCCTCCAGTGG - Intronic
1018415844 6:163601569-163601591 CAGGACTGAGTTCCTTCCAGAGG + Intergenic
1018750086 6:166796757-166796779 CAGTCCTGAGTGCACGCACGTGG + Intronic
1018750088 6:166796809-166796831 CAGTCCTGAGTGCACGCACGTGG + Intronic
1018750090 6:166796861-166796883 CAGTCCTGAGTGCACCCATGTGG + Intronic
1019642181 7:2109412-2109434 CACTCTTGAGTGTCCTCCTGGGG - Intronic
1019769869 7:2876892-2876914 CAGTCCTGTGTGCCCTTTGGTGG - Intergenic
1021846949 7:24772196-24772218 AAGTGCTGAGTGCCTTCCATAGG + Intergenic
1022110279 7:27225849-27225871 CAGGCTTGAGCGCCCTCCTGGGG - Intergenic
1022510747 7:30933548-30933570 CAGTCCTGCCTGCCCGCCTGTGG + Intergenic
1024617043 7:51124682-51124704 CAGTGCTGAGTGCCTTCAAAGGG + Intronic
1030333267 7:108295865-108295887 CACTCCTCTGTGCCCTGCAGAGG - Intronic
1035628440 8:1090634-1090656 GAGCCCTGAGGGGCCTCCAGAGG + Intergenic
1040610289 8:48976928-48976950 CAGTCCTCAGTGCCCCACACCGG - Intergenic
1041540757 8:58982283-58982305 TACTCCTGAGTGCTCCCCAGAGG + Intronic
1044240398 8:89881575-89881597 CAGTCCTGAGTGCTCTGCCTTGG + Intergenic
1045180278 8:99773517-99773539 CTGTCCTGAGTGACCTACAGAGG - Intronic
1048478949 8:134769974-134769996 CTGTCCTGTGTGCCACCCAGGGG - Intergenic
1048680829 8:136839892-136839914 CTGTAGTGAGTGCCTTCCAGTGG + Intergenic
1050204387 9:3181646-3181668 CTTTCCAGCGTGCCCTCCAGGGG - Intergenic
1052773749 9:32712743-32712765 AAGTCCTGAGTGACCTACAAAGG + Intergenic
1055320985 9:75083331-75083353 CAGTCCTGAGCACACCCCAGTGG - Intronic
1056792291 9:89633606-89633628 CAGCCCTGGGGGCCCTCCATGGG + Intergenic
1060277328 9:122191995-122192017 CATTCCTGGGTGCCCACCAAGGG + Intronic
1185484909 X:474917-474939 CAGGGCTGAGCTCCCTCCAGAGG + Intergenic
1186246302 X:7620162-7620184 AAGTCCTGAATCCTCTCCAGTGG + Intergenic
1187123099 X:16428079-16428101 CATTCTTGTGTGCCCTGCAGTGG - Intergenic
1188751078 X:33906286-33906308 CAGGACTGAGTGGCCTCCAAGGG + Intergenic
1195752806 X:108174824-108174846 CAGTGCTCAGGGTCCTCCAGGGG + Intronic
1196403132 X:115336598-115336620 CACTCCTGAGTGGCCTCAATTGG + Intergenic
1196816162 X:119666961-119666983 CAAACCTCAGTGCCCTCGAGAGG - Intronic
1198936762 X:141907387-141907409 TAGTCCTCAGAGCCCTCCTGAGG + Exonic
1200323392 X:155213121-155213143 CACAGTTGAGTGCCCTCCAGGGG + Intronic
1201177304 Y:11316627-11316649 CAGTCCTGACAGCCCTCCGGAGG + Intergenic